No project description provided
Project description
PorechopX
PorechopX is a customized and enhanced version of the ARTICnetwork's fork of Porechop, a tool originally developed for finding and trimming adapters from Oxford Nanopore reads. PorechopX introduces several key improvements to improve performance:
Key Features and Modifications
- Rewrite using multiprocessing pool to enable real-time writing of results to the output. This replaces the original behavior where results were only written after all reads were processed, improving efficiency and reducing memory usage.
- Switch from SeqAn to parasail for local adapter alignment, and adjust the default length of adapter trimming from 4 to 10, which will produce more conservative alignments.
- There is no need for manual compilation of SeqAn library, and provides easy installation with
pip - Replaced the argparse module with click for nested command-line parsing.
What's not done:
- The verbose output (
--verbosity 2) has been dropped to avoid performance issues. However, it's useful under some circumstances and should be included in the future version.
Requirements
- Linux
- Python >=3.10, <3.12
Installation
Installing from PyPI:
pip install porechopx
Installing development version:
pip install git+https://bioinfo.biols.ac.cn/git/zhangjy/PorechopX.git
Quick usage examples
Basic adapter trimming:
porechopx -i input_reads.fastq.gz -o output_reads.fastq.gz
Trimmed reads to stdout, if you prefer:
porechopx -i input_reads.fastq.gz > output_reads.fastq
Demultiplex barcoded reads:
porechopx -i input_reads.fastq.gz -b output_dir
Demultiplex barcoded reads, straight from Albacore output directory:
porechopx -i albacore_dir -b output_dir
Also works with FASTA:
porechopx -i input_reads.fasta -o output_reads.fasta
More verbose output:
porechopx -i input_reads.fastq.gz -o output_reads.fastq.gz --verbosity 2
Got a big server?
porechopx -i input_reads.fastq.gz -o output_reads.fastq.gz --threads 40
Customize adapters
- The ARTIC's version of Porechop allows user specific additional adapters in csv format
| Adapter name | Direction {1=Forward,0=Reverse} | 5' start barcode | 3' end barcode |
|---|---|---|---|
| Custom Barcode 01 | 1 | ACTTGTACTTCGTTCAGTTGCGTATTGCTTTAACGGTAGAGTTTGATCCTGGCTCAG | AAGTCGTAACAAGGTAACCGTAGTAACGTAAGCAATGCGTAA |
| Custom Adapter 01 | 1 | ACTTGTACTTCGTTCAGTTGCGTATTGCTTTAACGGTAGAGTTTGATCCTGGCTCAG | AAGTCGTAACAAGGTAACCGTAGTAACGTAAGCAATGCGTAA |
NOTE
- Barcodes must include 'Barcode' in their names, otherwise will be treated as adapters**
Usage
PorechopX provides the same command-line interface (CLI) as porechop. Just replace porechop with
porechopx for better performance!
Usage: porechopx [OPTIONS]
PorechopX: a tool for finding adapters in Oxford Nanopore reads, trimming
them from the ends and splitting reads with internal adapters
Main options:
--version Show the version and exit.
-i, --input TEXT FASTA/FASTQ of input reads or a directory
which will be recursively searched for FASTQ
files [required]
-o, --output TEXT Filename for FASTA or FASTQ of trimmed reads
(if not set, trimmed reads will be printed
to stdout)
--barcode_stats_csv TEXT Path to a csv file with start/ end/ middle
barcode names and percentage identities for
each given read ( if not set, no information
will be printed)
--format [auto|fasta|fastq|fasta.gz|fastq.gz]
Output format for the reads - if auto, the
format will be chosen based on the output
filename or the input read format [default:
auto]
-v, --verbosity INTEGER Level of progress information: 0 = none, 1 =
some, 2 = lots, 3 = full - output will go to
stdout if reads are saved to a file and
stderr if reads are printed to stdout
[default: 1]
-t, --threads INTEGER Number of threads to use for adapter
alignment [default: (dynamic)]
-c, --chunk_size INTEGER Number of reads per chunk [default: 10,000]
Barcode binning settings:
Control the binning of reads based on barcodes (i.e. barcode demultiplexing)
-b, --barcode_dir TEXT Reads will be binned based on their barcode
and saved to separate files in this
directory (incompatible with --output)
--barcode_labels Reads will have a label added to their
header with their barcode
--extended_labels Reads will have an extended label added to
their header with the barcode_call (if any),
the best start/ end barcode hit and their
identities, and whether a barcode is found
in middle of read. (Dependent on
--barcode_labels).
--native_barcodes Only attempts to match the 24 native
barcodes
--pcr_barcodes Only attempts to match the 96 PCR barcodes
--rapid_barcodes Only attempts to match the 12 rapid barcodes
--limit_barcodes_to TEXT Specify a list of barcodes to look for
(numbers refer to native, PCR or rapid)
--custom_barcodes TEXT CSV file containing custom barcode sequences
--barcode_threshold FLOAT A read must have at least this percent
identity to a barcode to be binned
[default: 75.0]
--barcode_diff FLOAT If the difference between a read's best
barcode identity and its second-best barcode
identity is less than this value, it will
not be put in a barcode bin (to exclude
cases which are too close to call)
[default: 5.0]
--require_two_barcodes Reads will only be put in barcode bins if
they have a strong match for the barcode on
both their start and end (default: a read
can be binned with a match at its start or
end)
--untrimmed Bin reads but do not trim them (default:
trim the reads)
--discard_unassigned Discard unassigned reads (instead of
creating a "none" bin)
Adapter search settings:
Control how the program determines which adapter sets are present
--adapter_threshold FLOAT An adapter set has to have at least this
percent identity to be labelled as present
and trimmed off (0 to 100) [default: 90.0]
--check_reads INTEGER This many reads will be aligned to all
possible adapters to determine which adapter
sets are present [default: 10000]
--scoring_scheme TEXT Comma-delimited string of alignment scores:
match, mismatch, gap open, gap extend
[default: 3,-6,5,2]
End adapter settings:
Control the trimming of adapters from read ends
--end_size INTEGER The number of base pairs at each end of the
read which will be searched for adapter
sequences [default: 150]
--min_trim_size INTEGER Adapter alignments smaller than this will be
ignored [default: 10]
--extra_end_trim INTEGER This many additional bases will be removed
next to adapters found at the ends of reads
[default: 2]
--end_threshold FLOAT Adapters at the ends of reads must have at
least this percent identity to be removed (0
to 100) [default: 75.0]
Middle adapter settings:
Control the splitting of read from middle adapters
--no_split Skip splitting reads based on middle
adapters (default: split reads when an
adapter is found in the middle)
--discard_middle Reads with middle adapters will be discarded
(default: reads with middle adapters are
split)
--middle_threshold FLOAT Adapters in the middle of reads must have at
least this percent identity to be found (0
to 100) [default: 90.0]
--extra_middle_trim_good_side INTEGER
This many additional bases will be removed
next to middle adapters on their "good" side
[default: 10]
--extra_middle_trim_bad_side INTEGER
This many additional bases will be removed
next to middle adapters on their "bad" side
[default: 100]
--min_split_read_size INTEGER Post-split read pieces smaller than this
many base pairs will not be outputted
[default: 1000]
Help:
--help Show this message and exit.
--version Show the version and exit.
Credits
PorechopX is based on the orginal version of Porechop and the modified version of Porechop by ARTIC Network. Many thanks for developing a convenient software for processing nanopore data.
Documentation
For detailed description of the adapter trimming strategy, please refer to Porechop Documentation
License
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file porechopx-0.2.0.tar.gz.
File metadata
- Download URL: porechopx-0.2.0.tar.gz
- Upload date:
- Size: 44.6 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: poetry/1.6.1 CPython/3.9.16 Linux/4.18.0-240.15.1.el8_3.x86_64
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
5f2a43539c7013e4fbfbce903226cc33dc701daa8cf56d5b5d994c27b0c94b64
|
|
| MD5 |
b8e07bd610bd8c4326cff3ba5d93cc33
|
|
| BLAKE2b-256 |
cbb9c5abbe84ebdeb3924cc0a91cc4775770d1245a848a047ae46c05069461c0
|
File details
Details for the file porechopx-0.2.0-py3-none-any.whl.
File metadata
- Download URL: porechopx-0.2.0-py3-none-any.whl
- Upload date:
- Size: 44.7 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: poetry/1.6.1 CPython/3.9.16 Linux/4.18.0-240.15.1.el8_3.x86_64
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
a7fde5d2e9aff0325732c4cb849702cad473f4ebfda08d2357f769e69de99c08
|
|
| MD5 |
ac238a69b198af1fad7c04b482279e2c
|
|
| BLAKE2b-256 |
4323b0cefec7bb2e965fc036659a3a57497bc0b735e95fcf3a547bd29a9028d7
|