Skip to main content

No project description provided

Project description

PorechopX

PorechopX is a customized and enhanced version of the ARTICnetwork's fork of Porechop, a tool originally developed for finding and trimming adapters from Oxford Nanopore reads. PorechopX introduces several key improvements to improve performance:

Key Features and Modifications

  • Rewrite using multiprocessing pool to enable real-time writing of results to the output. This replaces the original behavior where results were only written after all reads were processed, improving efficiency and reducing memory usage.
  • Switch from SeqAn to parasail for local adapter alignment, and adjust the default length of adapter trimming from 4 to 10, which will produce more conservative alignments.
  • There is no need for manual compilation of SeqAn library, and provides easy installation with pip
  • Replaced the argparse module with click for nested command-line parsing.

What's not done:

  • The verbose output (--verbosity 2) has been dropped to avoid performance issues. However, it's useful under some circumstances and should be included in the future version.

Requirements

Installation

Installing from PyPI:

pip install porechopx

Installing development version:

pip install git+https://bioinfo.biols.ac.cn/git/zhangjy/PorechopX.git

Quick usage examples

Basic adapter trimming:
porechopx -i input_reads.fastq.gz -o output_reads.fastq.gz

Trimmed reads to stdout, if you prefer:
porechopx -i input_reads.fastq.gz > output_reads.fastq

Demultiplex barcoded reads:
porechopx -i input_reads.fastq.gz -b output_dir

Demultiplex barcoded reads, straight from Albacore output directory:
porechopx -i albacore_dir -b output_dir

Also works with FASTA:
porechopx -i input_reads.fasta -o output_reads.fasta

More verbose output:
porechopx -i input_reads.fastq.gz -o output_reads.fastq.gz --verbosity 2

Got a big server?
porechopx -i input_reads.fastq.gz -o output_reads.fastq.gz --threads 40

Customize adapters

  • The ARTIC's version of Porechop allows user specific additional adapters in csv format
Adapter name Direction {1=Forward,0=Reverse} 5' start barcode 3' end barcode
Custom Barcode 01 1 ACTTGTACTTCGTTCAGTTGCGTATTGCTTTAACGGTAGAGTTTGATCCTGGCTCAG AAGTCGTAACAAGGTAACCGTAGTAACGTAAGCAATGCGTAA
Custom Adapter 01 1 ACTTGTACTTCGTTCAGTTGCGTATTGCTTTAACGGTAGAGTTTGATCCTGGCTCAG AAGTCGTAACAAGGTAACCGTAGTAACGTAAGCAATGCGTAA

NOTE

  • Barcodes must include 'Barcode' in their names, otherwise will be treated as adapters**

Usage

PorechopX provides the same command-line interface (CLI) as porechop. Just replace porechop with porechopx for better performance!

Usage: porechopx [OPTIONS]

  PorechopX: a tool for finding adapters in Oxford Nanopore reads, trimming
  them from the ends and splitting reads with internal adapters

Main options:
  --version                       Show the version and exit.
  -i, --input TEXT                FASTA/FASTQ of input reads or a directory
                                  which will be recursively searched for FASTQ
                                  files  [required]
  -o, --output TEXT               Filename for FASTA or FASTQ of trimmed reads
                                  (if not set, trimmed reads will be printed
                                  to stdout)
  --barcode_stats_csv TEXT        Path to a csv file with start/ end/ middle
                                  barcode names and percentage identities for
                                  each given read ( if not set, no information
                                  will be printed)
  --format [auto|fasta|fastq|fasta.gz|fastq.gz]
                                  Output format for the reads - if auto, the
                                  format will be chosen based on the output
                                  filename or the input read format  [default:
                                  auto]
  -v, --verbosity INTEGER         Level of progress information: 0 = none, 1 =
                                  some, 2 = lots, 3 = full - output will go to
                                  stdout if reads are saved to a file and
                                  stderr if reads are printed to stdout
                                  [default: 1]
  -t, --threads INTEGER           Number of threads to use for adapter
                                  alignment  [default: (dynamic)]
  -c, --chunk_size INTEGER        Number of reads per chunk  [default: 10,000]

Barcode binning settings:
  Control the binning of reads based on barcodes (i.e. barcode demultiplexing)

  -b, --barcode_dir TEXT          Reads will be binned based on their barcode
                                  and saved to separate files in this
                                  directory (incompatible with --output)
  --barcode_labels                Reads will have a label added to their
                                  header with their barcode
  --extended_labels               Reads will have an extended label added to
                                  their header with the barcode_call (if any),
                                  the best start/ end barcode hit and their
                                  identities, and whether a barcode is found
                                  in middle of read. (Dependent on
                                  --barcode_labels).
  --native_barcodes               Only attempts to match the 24 native
                                  barcodes
  --pcr_barcodes                  Only attempts to match the 96 PCR barcodes
  --rapid_barcodes                Only attempts to match the 12 rapid barcodes
  --limit_barcodes_to TEXT        Specify a list of barcodes to look for
                                  (numbers refer to native, PCR or rapid)
  --custom_barcodes TEXT          CSV file containing custom barcode sequences
  --barcode_threshold FLOAT       A read must have at least this percent
                                  identity to a barcode to be binned
                                  [default: 75.0]
  --barcode_diff FLOAT            If the difference between a read's best
                                  barcode identity and its second-best barcode
                                  identity is less than this value, it will
                                  not be put in a barcode bin (to exclude
                                  cases which are too close to call)
                                  [default: 5.0]
  --require_two_barcodes          Reads will only be put in barcode bins if
                                  they have a strong match for the barcode on
                                  both their start and end (default: a read
                                  can be binned with a match at its start or
                                  end)
  --untrimmed                     Bin reads but do not trim them (default:
                                  trim the reads)
  --discard_unassigned            Discard unassigned reads (instead of
                                  creating a "none" bin)

Adapter search settings:
  Control how the program determines which adapter sets are present

  --adapter_threshold FLOAT       An adapter set has to have at least this
                                  percent identity to be labelled as present
                                  and trimmed off (0 to 100)  [default: 90.0]
  --check_reads INTEGER           This many reads will be aligned to all
                                  possible adapters to determine which adapter
                                  sets are present  [default: 10000]
  --scoring_scheme TEXT           Comma-delimited string of alignment scores:
                                  match, mismatch, gap open, gap extend
                                  [default: 3,-6,5,2]

End adapter settings:
  Control the trimming of adapters from read ends

  --end_size INTEGER              The number of base pairs at each end of the
                                  read which will be searched for adapter
                                  sequences  [default: 150]
  --min_trim_size INTEGER         Adapter alignments smaller than this will be
                                  ignored  [default: 10]
  --extra_end_trim INTEGER        This many additional bases will be removed
                                  next to adapters found at the ends of reads
                                  [default: 2]
  --end_threshold FLOAT           Adapters at the ends of reads must have at
                                  least this percent identity to be removed (0
                                  to 100)  [default: 75.0]

Middle adapter settings:
  Control the splitting of read from middle adapters

  --no_split                      Skip splitting reads based on middle
                                  adapters (default: split reads when an
                                  adapter is found in the middle)
  --discard_middle                Reads with middle adapters will be discarded
                                  (default: reads with middle adapters are
                                  split)
  --middle_threshold FLOAT        Adapters in the middle of reads must have at
                                  least this percent identity to be found (0
                                  to 100)  [default: 90.0]
  --extra_middle_trim_good_side INTEGER
                                  This many additional bases will be removed
                                  next to middle adapters on their "good" side
                                  [default: 10]
  --extra_middle_trim_bad_side INTEGER
                                  This many additional bases will be removed
                                  next to middle adapters on their "bad" side
                                  [default: 100]
  --min_split_read_size INTEGER   Post-split read pieces smaller than this
                                  many base pairs will not be outputted
                                  [default: 1000]

Help:
  --help                          Show this message and exit.
  --version                       Show the version and exit.

Credits

PorechopX is based on the orginal version of Porechop and the modified version of Porechop by ARTIC Network. Many thanks for developing a convenient software for processing nanopore data.

Documentation

For detailed description of the adapter trimming strategy, please refer to Porechop Documentation

License

GNU General Public License, version 3

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

porechopx-0.2.0.tar.gz (44.6 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

porechopx-0.2.0-py3-none-any.whl (44.7 kB view details)

Uploaded Python 3

File details

Details for the file porechopx-0.2.0.tar.gz.

File metadata

  • Download URL: porechopx-0.2.0.tar.gz
  • Upload date:
  • Size: 44.6 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: poetry/1.6.1 CPython/3.9.16 Linux/4.18.0-240.15.1.el8_3.x86_64

File hashes

Hashes for porechopx-0.2.0.tar.gz
Algorithm Hash digest
SHA256 5f2a43539c7013e4fbfbce903226cc33dc701daa8cf56d5b5d994c27b0c94b64
MD5 b8e07bd610bd8c4326cff3ba5d93cc33
BLAKE2b-256 cbb9c5abbe84ebdeb3924cc0a91cc4775770d1245a848a047ae46c05069461c0

See more details on using hashes here.

File details

Details for the file porechopx-0.2.0-py3-none-any.whl.

File metadata

  • Download URL: porechopx-0.2.0-py3-none-any.whl
  • Upload date:
  • Size: 44.7 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: poetry/1.6.1 CPython/3.9.16 Linux/4.18.0-240.15.1.el8_3.x86_64

File hashes

Hashes for porechopx-0.2.0-py3-none-any.whl
Algorithm Hash digest
SHA256 a7fde5d2e9aff0325732c4cb849702cad473f4ebfda08d2357f769e69de99c08
MD5 ac238a69b198af1fad7c04b482279e2c
BLAKE2b-256 4323b0cefec7bb2e965fc036659a3a57497bc0b735e95fcf3a547bd29a9028d7

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page