Model-based inference of P-site offsets
Project description
PSite
PSite is a python package that predicts P-site offsets for footprints generated in ribosome profiling using a Gradient Boosting Trees (GBT) model trained with footprints around both annotated start and stop codons. PSite can report estimated P-site offsets in two manners:
- append a
PStag to each original alignment inSAMorBAMformat, without any other modifications; - output a new
BAMfile of the alignments of P-site locations only;
To demonstrate the usage of the PS tag, PSite also has a coverage module that performs genome-wide calculation of P-site coverage of ribosome footprints at nucleotide resolution.
Dependency
numpy>= 1.21.2- 1.3.4 <=
pandas< 2.0.0 biopython>= 1.79scikit-learn>= 1.1.1pysam>= 0.17.0pyBigWig>= 0.3.18click>= 8.1.2seaborn>= 0.11.0
Install and uninstall
To install PSite, run
pip install psite
Alternatively, download the package tarball from the release page and run
pip install psite-version-py3-none-any.whl
To uninstall it, simply run
pip uninstall psite
Build distributions from source
Run the following command in the source directory
python3 -m build
Usage
PSite is designed to be used from the command line on Unix-like operating systems such as Linux or macOS.
$ psite -h
Usage: psite [OPTIONS] COMMAND [ARGS]...
main interface
Options:
-h, --help Show this message and exit.
Commands:
coverage calculate the coverage for plus strand and minus strand...
pbam generate bam with only P-site regions
predict load pre-trained model and predict P-site offsets
setp set global fixed P-site offset tag
train train a model for P-site offset prediction
train
The core module that trains the GBT model for P-site offset prediction. It requires transcriptome alignments (PATH_BAM) and the corresponding sequences of all transcripts (PATH_REF). The required bam can be generated by mapping footprints to the reference genome using STAR and output transcriptome alignments with parameter --quantMode TranscriptomeSAM. The trained model is saved in pickle format for later use.
$ psite train -h
Usage: psite train [OPTIONS] PATH_REF PATH_BAM OUTPUT_PREFIX PATH_TXINFO
train a model for P-site offset prediction
path_ref : reference transcriptome (fasta) matching the bam
path_bam : alignments of RPFs to reference transcriptome
output_prefix: output prefix of fitted models and logs
path_txinfo : transcriptome annotation
Options:
-t, --type_rep [longest|principal|kallisto|salmon]
type of representative transcripts
[default: longest]
-e, --path_exp TEXT path of transcript expression quant results
-i, --ignore_txversion ignore transcript version in
".\d+" format [default: False]
-n, --nts INTEGER flanking nucleotides to consider at each side
[default: 3]
-f, --frac FLOAT fraction of alignments for training (for
large datasets) [default: 1.0]
--offset_min INTEGER lower bound of distance between RPF 5p and
start codon [default: 10]
--offset_max INTEGER upper bound of distance between RPF 5p and
start codon [default: 14]
-d, --max_depth INTEGER max depth of trees [default: 3]
-m, --min_samples_split INTEGER
min number of alignments required to split
an internal node [default: 6]
-k, --keep whether to keep intermediate results
[default: False]
-h, --help Show this message and exit. [default:
False]
predict
This module predicts P-site for each alignment using a pre-trained model and append a PS tag (for "P-site") to the original alignment. The input can be either genomic alignments or transcriptomic alignments.
$ psite predict -h
Usage: psite predict [OPTIONS] PATH_REF PATH_BAM PATH_MODEL PATH_OUT
load pre-trained model and predict P-site offsets
path_ref : reference transcriptome (fasta) matching the bam
path_bam : alignments of RPFs to reference transcriptome
path_model : path to save the fitted model
path_out : output path of bam with PS (for P-site) tag
Options:
-i, --ignore_txversion ignore transcript version in ".\d+"
format [default: False]
-l, --rlen_min INTEGER lower bound for mapped read length
-u, --rlen_max INTEGER upper bound for mapped read length
-c, --chunk_size INTEGER chunk size for prediction batch [default: 100000]
-h, --help Show this message and exit. [default: False]
pbam
This module predicts P-site for each alignment and keeps only the first nucleotide after excluding the P-site offset. Thus, each alignment in the output contains a single site. The input can be either genomic alignments or transcriptomic alignments.
$ psite pbam -h
Usage: psite pbam [OPTIONS] PATH_REF PATH_BAM PATH_MODEL PATH_OUT
generate bam with only P-site regions
path_ref : reference transcriptome (fasta) matching the bam
path_bam : alignments of RPFs to reference transcriptome
path_model : path to save the fitted model
path_out : output path of bam with P-site regions only
Options:
-f, --out_format [bam|sam] P-site alignment output format [default: bam]
-i, --ignore_txversion ignore transcript version in ".\d+"
format [default: False]
-l, --rlen_min INTEGER lower bound for mapped read length
-u, --rlen_max INTEGER upper bound for mapped read length
-c, --chunk_size INTEGER chunk size for prediction batch [default:
100000]
-h, --help Show this message and exit. [default: False]
coverage
This module calculates the genome or transcriptome-wide coverage of RPF P-sites using the PS tag generatd by predict module.
$ psite coverage -h
Usage: psite coverage [OPTIONS] PATH_BAM PREFIX
calculate the coverage for plus strand and minus strand separately
path_bam: sorted alignment bam file with the PS tag (for P-site offset)
prefix : output prefix of P-site coverage tracks in bigWig format
Options:
-l, --rlen_min INTEGER lower bound for RPF mapped length [default: 25]
-u, --rlen_max INTEGER upper bound for mapped read length [default: 40]
-q, --mapq_min INTEGER minimum mapping quality [default: 10]
-i, --ignore_supp whether to ignore supplementary alignments
[default: False]
-h, --help Show this message and exit. [default: False]
setp
This module sets a global fixed value for the "PS" tag.
$ psite setp -h
Usage: psite setp [OPTIONS] PATH_BAM PATH_OUT
set global fixed P-site offset tag
path_bam : alignments of RPFs to reference transcriptome
path_out : output path of bam with PS (for P-site) tag
Options:
-l, --rlen_min INTEGER lower bound for mapped read length [default: 27]
-u, --rlen_max INTEGER upper bound for mapped read length [default: 35]
-n, --nucleotides INTEGER fixed global offset value [default: 12]
-h, --help Show this message and exit.
An example workflow to use PSite
Prepare input files
After trimming adapters and optionally removing reads derived from rRNAs or tRNAs, map ribosomal footprints to the reference genome with STAR:
STAR --runThreadN 16 --outFilterType BySJout --outFilterMismatchNmax 2 --genomeDir genome_index --readFilesIn sample_RPF.fq.gz --outFileNamePrefix sample_RPF --readFilesCommand zcat --outSAMtype BAM SortedByCoordinate --quantMode TranscriptomeSAM --outFilterMultimapNmax 1 --outFilterMatchNmin 16 --alignEndsType EndToEnd --outSAMattributes NH HI AS nM NM MD
The parameter --quantMode TranscriptomeSAM will instruct STAR to translate the genomic alignments into transcript alignments, which will be used to train the GBT model. Since many uniquely mapped reads in genomic alignments will become multi-mapping reads in transcriptome alignment due to the presence of alternative transcript isoforms, --outFilterMultimapNmax 1 parameter is included to exlude only multi-mapping reads in genomic alignments.
PSite needs to know the position of annotated start codons and stop codons of all protein-coding transcripts, which can be obtained with the helper scripts located in the scripts directory:
Rscript --vanilla scripts/extract_txinfo_ensembl.R gene_annotations.gtf txinfo.tsv
Only a represent isoform is used in the analysis for a gene with multiple transcript isoforms. By default, PSite uses the longest transcript. However, a more reasonable choice is the most abundant isoform. Therefore, if the information of transcript abundance as calculated by kallisto or salmon is provided, PSite can automatically determine the most abundant transcript isoform for later use:
salmon quant -p4 --seqBias --gcBias --posBias -l A -i salmon_index -r sample_RNA.fq.gz -o salmon_results
Run PSite
The first step is to train a GBT model with train module with the transcriptome bam. Then, the fitted model will be saved in pickle format.
psite train -i -t salmon -e salmon_results/quant.sf \
all_transcripts.fa sample_RPF.Aligned.toTranscriptome.out.bam output_prefix txinfo.tsv
Model training is slow for large datasets. -f parameter can be used to select only a subset of alignments for training. This can significantly improve speed and reduce memory usage while maintaining similar accuracy.
Once the model is successfully trained, it can be used to predict P-site offsets for ribosome footprints that are mapped to the reference genome or reference transcriptomes. It should be noted that if you use genome bam for prediction, genomic fasta should be used as input, and vice versa.
# with transcriptomic bam
psite predict -i all_transcripts.fa sample_RPF.Aligned.toTranscriptome.out.bam output_prefix.gbt.pickle sample_RPF.transcriptome.tag.bam
# with genomic bam
psite predict -i genome.fa sample_RPF.Aligned.sortedByCoord.out.bam output_prefix.gbt.pickle sample_RPF.genome.tag.bam
example output:
r1 16 2L 10716 255 29M * 0 0 TACAATTTATTAAATGGGGACGGACCAAT IIIIIIIIIIIIIIIIIIIIIHIIDDDDD NH:i:1 HI:i:1 AS:i:28 nM:i:0 NM:i:0 MD:Z:29 jM:B:c,-1 jI:B:i,-1 PS:i:10
r2 16 2L 10836 255 33M * 0 0 TGTCAACTTTTATCCTTTGTACCTTTCTACAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIDDDDD NH:i:1 HI:i:1 AS:i:32 nM:i:0 NM:i:0 MD:Z:33 jM:B:c,-1 jI:B:i,-1 PS:i:12
r3 16 2L 10891 255 30M * 0 0 CGGGTAAAGGGTATAAAGTCACTACGCGAA GGD1HEC?HHIHHGF<1?IHHDHHF0@DD0 NH:i:1 HI:i:1 AS:i:29 nM:i:0 NM:i:0 MD:Z:30 jM:B:c,-1 jI:B:i,-1 PS:i:12
r4 16 2L 11027 255 31M * 0 0 TTTCTGTTTGTATGTAAATCGCGTTTAATTT IIIIIIIIIIIIIIIIIIIIIIIIIIDDDDD NH:i:1 HI:i:1 AS:i:30 nM:i:0 NM:i:0 MD:Z:31 jM:B:c,-1 jI:B:i,-1 PS:i:12
r5 16 2L 11073 255 32M * 0 0 CGTTCCTATTTTGCTGTCCCCGTTCGATTTTT IHHIIIIIIIIIIIIIIHIIIIHIIIIDDDDD NH:i:1 HI:i:1 AS:i:31 nM:i:0 NM:i:0 MD:Z:32 jM:B:c,-1 jI:B:i,-1 PS:i:12
r6 16 2L 11077 255 29M * 0 0 CCTATTTTGCTGTCCCCGTTCGATTTTTA @CC?FCD<<CG</H@HDHHHIHCF0?@@D NH:i:1 HI:i:1 AS:i:28 nM:i:0 NM:i:0 MD:Z:29 jM:B:c,-1 jI:B:i,-1 PS:i:12
r7 16 2L 11132 255 31M * 0 0 AAATTACATCAGGACTAGTACTCGTTTGCGT IIIHIIHIIIIIHIHIIIHHIGIIIIDDDBD NH:i:1 HI:i:1 AS:i:30 nM:i:0 NM:i:0 MD:Z:31 jM:B:c,-1 jI:B:i,-1 PS:i:11
r8 16 2L 11138 255 32M * 0 0 CATCAGGACTAGTACTCGTTTGCGTCGTATTT 1HHHIIHIHGIHIIIIIIHHIIHGGHHDDD@@ NH:i:1 HI:i:1 AS:i:31 nM:i:0 NM:i:0 MD:Z:32 jM:B:c,-1 jI:B:i,-1 PS:i:12
r9 16 2L 11138 255 29M * 0 0 CATCAGGACTAGTACTCGTTTGCGTCGTA CFEGFHFCIHIHIIIHDIGIIHCHD<BB? NH:i:1 HI:i:1 AS:i:28 nM:i:0 NM:i:0 MD:Z:29 jM:B:c,-1 jI:B:i,-1 PS:i:10
r10 16 2L 11140 255 32M * 0 0 TCAGGACTAGTACTCGTTTGCGTCGTATTTCT FCCHHCHIHIHHE0HHHDECHIH?IHG@0@D@ NH:i:1 HI:i:1 AS:i:31 nM:i:0 NM:i:0 MD:Z:32 jM:B:c,-1 jI:B:i,-1 PS:i:13
It is also possible to output alignments with P-site locations only, which can be used for downstream applications such as translated ORF prediction with RibORF.
psite pbam -f sam genome.fa sample_RPF.Aligned.sortedByCoord.out.bam output_prefix.gbt.pickle sample_RPF.genome.psite.sam
Here are a few lines from an example output:
r1 16 1 531180 255 1M * 0 0 G J NH:i:1 HI:i:1 AS:i:30 nM:i:0 NM:i:0 MD:Z:31
r2 16 1 531180 255 1M * 0 0 G J NH:i:1 HI:i:1 AS:i:30 nM:i:0 NM:i:0 MD:Z:31
r3 0 1 629921 255 1M * 0 0 A J NH:i:1 HI:i:1 AS:i:31 nM:i:1 NM:i:1 MD:Z:0C33
r4 0 1 629921 255 1M * 0 0 A J NH:i:1 HI:i:1 AS:i:31 nM:i:1 NM:i:1 MD:Z:0C33
r5 0 1 629922 255 1M * 0 0 T J NH:i:1 HI:i:1 AS:i:32 nM:i:0 NM:i:0 MD:Z:33
r6 0 1 629922 255 1M * 0 0 T J NH:i:1 HI:i:1 AS:i:29 nM:i:1 NM:i:1 MD:Z:0C31
r7 0 1 629922 255 1M * 0 0 T J NH:i:1 HI:i:1 AS:i:29 nM:i:1 NM:i:1 MD:Z:0C31
r8 0 1 629922 255 1M * 0 0 T J NH:i:1 HI:i:1 AS:i:29 nM:i:1 NM:i:1 MD:Z:0C31
r9 0 1 629922 255 1M * 0 0 T J NH:i:1 HI:i:1 AS:i:32 nM:i:0 NM:i:0 MD:Z:33
r10 0 1 629922 255 1M * 0 0 T J NH:i:1 HI:i:1 AS:i:30 nM:i:1 NM:i:1 MD:Z:0C32
PSite also has a module for fast calculation of genome or transcriptome P-site coverage of ribosome footprints. The alignments should be sorted by coordinates before coverage calculation.
# sort bam
samtools sort -@ 8 -O bam -o sample_RPF.genome.tag.sorted.bam sample_RPF.genome.tag.bam
# calculate coverage
psite coverage sample_RPF.genome.tag.sorted.bam sample_RPF.psite_cov
NEW: a complete example of how to run PSite and use PSite output for downstream analyses is available from the repository associated with PSite manuscript.
Other information
Please use the issues panel for questions related to PSite, bug reports, or feature requests. If you use psite in your work, you can cite it as follows:
Chang, Y., Lei, T., Zhang, H., 2023. PSite: inference of read-specific P-site offsets for ribosomal footprints. bioRxiv, 2023.2006.2027.546788. https://doi.org/10.1101/2023.06.27.546788.
Project details
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file psite-0.1.6.tar.gz.
File metadata
- Download URL: psite-0.1.6.tar.gz
- Upload date:
- Size: 19.2 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/4.0.2 CPython/3.10.13
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
8070be93e9dcd6acb89f9a2e6844fe228488f47cb54ccf4ebd442523f746ade9
|
|
| MD5 |
45a53a8c07952c6b97bab2dbd2cfa9ec
|
|
| BLAKE2b-256 |
e87874fb33d6ae9ce6e5f32f7a74d454223c181311de7b2929955f8bdb899be8
|
File details
Details for the file psite-0.1.6-py3-none-any.whl.
File metadata
- Download URL: psite-0.1.6-py3-none-any.whl
- Upload date:
- Size: 18.6 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/4.0.2 CPython/3.10.13
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
f721a033b40e5cdeadbc3cecbc90610326cab2541a86e2d33b9e65a161e36997
|
|
| MD5 |
8dcaa7fcfb14ca8b59276639b38fe2ab
|
|
| BLAKE2b-256 |
bd4f6df7365d568e99644978e9b2b01b0f51ef87de7b6b51c5bad01cd9584039
|