This is a bioinformatic python package.
1. Install
pip install pybioinformatic --upgrade
2. Issue
ImportError: libffi.so.7: cannot open shared object file: No such file or directory
# First use the following command to verify that the file exists in that path.
ls /usr/lib/x86_64-linux-gnu/libffi.so.7
# If libffi.so.6 is present on your system but libffi.so.7 is missing, you can try creating a soft link to an existing libffi.so.6 file.
ln -s /usr/lib/x86_64-linux-gnu/libffi.so.6 /usr/lib/x86_64-linux-gnu/libffi.so.7
# You can also install libffi7 with sudo grant.
sudo apt-get install libffi7
3. Usage example
RNA secondary structure prediction.
from pybioinformatic import Nucleotide
# Generate random nucleic acid sequence.
random_nucl = Nucleotide.random_nucl(name='demo', length=[100, 150], bias=1.0)
# Secondary structure prediction
ss, mfe = random_nucl.predict_secondary_structure('test/structure.ps')
print(ss, mfe, sep='\n')
>demo length=135
CAAAAAAAAACCATAAGCCGCCATGTCTCACATCGCAACCGGCTCAAGTAGAGTGCCCCTAATAATATGATCTTCGCTACAGAAGTTCCCCCCCCGCTGCCGGCTAGATGCGAACTCCACGCCTGGATGGCTCAG
...............((((((((.((......(((((.(.((((...((((.................((.((((......)))).))........)))).)))).).))))).......)).))).)))))...
-27.299999237060547
For more API reference, please refer to the follow user manual or source code.
1 maintainer
Metadata
1 maintainer
Release files for pybioinformatic 1.2.6
For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.
Source distribution (sdist)
| File | Size | Uploaded | |
|---|---|---|---|
| pybioinformatic-1.2.6.tar.gz | 607.4 kB | Details |
Built distribution (wheel)
| File | Interpreter | ABI | Platform | Reset |
|---|---|---|---|---|
| pybioinformatic-1.2.6-py3-none-any.whl | Python 3 | none | any | Details |
Total release size: 1.2 MB
Release files / pybioinformatic-1.2.6.tar.gz
| Download URL | pybioinformatic-1.2.6.tar.gz |
|---|---|
| Size | 607.4 kB |
| Tags | Source |
|
SHA-256 checksum How to use checksums |
5c37192764a659aa0661991d4088e24a23a1b59e980b233b02f32aeaf4c971db
|
|
BLAKE2b-256 checksum How to use checksums |
c72577d95979bfd370a64341848bebcdbcb94d23a6c021598c02f23878ca8e6b
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/6.1.0 CPython/3.8.20
|
Release files / pybioinformatic-1.2.6-py3-none-any.whl
| Download URL | pybioinformatic-1.2.6-py3-none-any.whl |
|---|---|
| Size | 617.8 kB |
| Tags | Python 3 |
|
SHA-256 checksum How to use checksums |
c12fb1fcb289a1ba65242d9fc9173734c4cd1da75a240507ab01a08158ae7378
|
|
BLAKE2b-256 checksum How to use checksums |
1e4e0c0362fe5195f819c3a3ecfab70c8899a60caa90831d7b4b81197478310e
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/6.1.0 CPython/3.8.20
|
