Language Code Style Type Checked PEP8 Code Coverage License

Python package PyPI version PyPI download total Bioconda DOI

pybwa

Python bindings for bwa, the Burrows-Wheeler Aligner. Pybwa provides native Python access to bwa's indexing and alignment algorithms, returning pysam AlignedSegment objects for downstream analysis.

Fulcrum Genomics

Visit us at Fulcrum Genomics to learn more about how we can power your Bioinformatics with pybwa and beyond.

Quick Start

Align reads with bwa mem

bwa mem is the recommended algorithm for reads longer than ~70bp (Illumina, etc.).

from pybwa import BwaMem

mem = BwaMem(prefix="/path/to/genome.fasta")
for recs in mem.align(queries=["CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA"]):
    for rec in recs:
        print(rec)

Align short reads with bwa aln

bwa aln is designed for short reads (<100bp, e.g. Illumina).

from pybwa import BwaAln

aln = BwaAln(prefix="/path/to/genome.fasta")
for rec in aln.align(queries=["GATTACA"]):
    print(rec)

Reuse an index across aligners

Load a BwaIndex once and pass it to multiple aligners to avoid reloading:

from pybwa import BwaIndex, BwaAln, BwaMem

index = BwaIndex(prefix="/path/to/genome.fasta")
aln = BwaAln(index=index)
mem = BwaMem(index=index)

Installation

Install with pip install pybwa or conda install -c bioconda pybwa.

Requires Python 3.10+

Documentation

See the full documentation on pybwa.readthedocs.org.

Fulcrum Genomics

Visit us at Fulcrum Genomics to learn more about how we can power your Bioinformatics with pybwa and beyond.

Key dates

PyPI data
Data sourced directly from PyPI's database.
  • Released:
Latest release

1 maintainer

PyPI data
Data sourced directly from PyPI's database.
Avatar for nilshomer from gravatar.com nilshomer

Credits

Author: Nils Homer

License expression

MIT
View SPDX License List

Requires

Python <4.0, >=3.10.0

Tags

bioinformatics

Classifiers

Report project as malware

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

pybwa-2.3.2.tar.gz (7.9 MB view details)

Uploaded Source

Built Distributions

If you're not sure about the file name format, learn more about wheel file names.

pybwa-2.3.2-cp314-cp314-musllinux_1_2_x86_64.whl (13.2 MB view details)

Uploaded CPython 3.14musllinux: musl 1.2+ x86-64

pybwa-2.3.2-cp314-cp314-musllinux_1_2_aarch64.whl (12.9 MB view details)

Uploaded CPython 3.14musllinux: musl 1.2+ ARM64

pybwa-2.3.2-cp314-cp314-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl (13.4 MB view details)

Uploaded CPython 3.14manylinux: glibc 2.27+ x86-64manylinux: glibc 2.28+ x86-64

pybwa-2.3.2-cp314-cp314-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl (12.7 MB view details)

Uploaded CPython 3.14manylinux: glibc 2.27+ ARM64manylinux: glibc 2.28+ ARM64

pybwa-2.3.2-cp313-cp313-musllinux_1_2_x86_64.whl (13.2 MB view details)

Uploaded CPython 3.13musllinux: musl 1.2+ x86-64

pybwa-2.3.2-cp313-cp313-musllinux_1_2_aarch64.whl (12.9 MB view details)

Uploaded CPython 3.13musllinux: musl 1.2+ ARM64

pybwa-2.3.2-cp313-cp313-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl (13.4 MB view details)

Uploaded CPython 3.13manylinux: glibc 2.27+ x86-64manylinux: glibc 2.28+ x86-64

pybwa-2.3.2-cp313-cp313-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl (12.7 MB view details)

Uploaded CPython 3.13manylinux: glibc 2.27+ ARM64manylinux: glibc 2.28+ ARM64

pybwa-2.3.2-cp313-cp313-macosx_11_0_arm64.whl (3.4 MB view details)

Uploaded CPython 3.13macOS 11.0+ ARM64

pybwa-2.3.2-cp313-cp313-macosx_10_13_x86_64.whl (3.6 MB view details)

Uploaded CPython 3.13macOS 10.13+ x86-64

pybwa-2.3.2-cp312-cp312-musllinux_1_2_x86_64.whl (13.2 MB view details)

Uploaded CPython 3.12musllinux: musl 1.2+ x86-64

pybwa-2.3.2-cp312-cp312-musllinux_1_2_aarch64.whl (12.9 MB view details)

Uploaded CPython 3.12musllinux: musl 1.2+ ARM64

pybwa-2.3.2-cp312-cp312-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl (13.4 MB view details)

Uploaded CPython 3.12manylinux: glibc 2.27+ x86-64manylinux: glibc 2.28+ x86-64

pybwa-2.3.2-cp312-cp312-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl (12.7 MB view details)

Uploaded CPython 3.12manylinux: glibc 2.27+ ARM64manylinux: glibc 2.28+ ARM64

pybwa-2.3.2-cp312-cp312-macosx_11_0_arm64.whl (3.4 MB view details)

Uploaded CPython 3.12macOS 11.0+ ARM64

pybwa-2.3.2-cp312-cp312-macosx_10_13_x86_64.whl (3.6 MB view details)

Uploaded CPython 3.12macOS 10.13+ x86-64

pybwa-2.3.2-cp311-cp311-musllinux_1_2_x86_64.whl (13.2 MB view details)

Uploaded CPython 3.11musllinux: musl 1.2+ x86-64

pybwa-2.3.2-cp311-cp311-musllinux_1_2_aarch64.whl (12.9 MB view details)

Uploaded CPython 3.11musllinux: musl 1.2+ ARM64

pybwa-2.3.2-cp311-cp311-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl (13.4 MB view details)

Uploaded CPython 3.11manylinux: glibc 2.27+ x86-64manylinux: glibc 2.28+ x86-64

pybwa-2.3.2-cp311-cp311-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl (12.7 MB view details)

Uploaded CPython 3.11manylinux: glibc 2.27+ ARM64manylinux: glibc 2.28+ ARM64

pybwa-2.3.2-cp311-cp311-macosx_11_0_arm64.whl (3.4 MB view details)

Uploaded CPython 3.11macOS 11.0+ ARM64

pybwa-2.3.2-cp311-cp311-macosx_10_9_x86_64.whl (3.6 MB view details)

Uploaded CPython 3.11macOS 10.9+ x86-64

pybwa-2.3.2-cp310-cp310-musllinux_1_2_x86_64.whl (13.1 MB view details)

Uploaded CPython 3.10musllinux: musl 1.2+ x86-64

pybwa-2.3.2-cp310-cp310-musllinux_1_2_aarch64.whl (12.8 MB view details)

Uploaded CPython 3.10musllinux: musl 1.2+ ARM64

pybwa-2.3.2-cp310-cp310-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl (13.3 MB view details)

Uploaded CPython 3.10manylinux: glibc 2.27+ x86-64manylinux: glibc 2.28+ x86-64

pybwa-2.3.2-cp310-cp310-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl (12.6 MB view details)

Uploaded CPython 3.10manylinux: glibc 2.27+ ARM64manylinux: glibc 2.28+ ARM64

pybwa-2.3.2-cp310-cp310-macosx_11_0_arm64.whl (3.4 MB view details)

Uploaded CPython 3.10macOS 11.0+ ARM64

pybwa-2.3.2-cp310-cp310-macosx_10_9_x86_64.whl (3.6 MB view details)

Uploaded CPython 3.10macOS 10.9+ x86-64

File details

Details for the file pybwa-2.3.2.tar.gz.

File metadata

  • Download URL: pybwa-2.3.2.tar.gz
  • Upload date:
  • Size: 7.9 MB
  • Tags: Source
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/6.1.0 CPython/3.13.13

File hashes

Hashes for pybwa-2.3.2.tar.gz
Algorithm Hash digest
SHA256 b2a25b358f1f8fa069cd8a4d15ab730497b90095645a59d6f9a03b56261afae9
MD5 510fc551bfb7ffa28a70ae4c66bb5398
BLAKE2b-256 1d68d185225ca151d487b89873e93d27afb071e4668841c181611fc981bb89d4

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2.tar.gz:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp314-cp314-musllinux_1_2_x86_64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp314-cp314-musllinux_1_2_x86_64.whl
Algorithm Hash digest
SHA256 e4fc8ff428d2845ca1409e3e7003f8995add8f0f876742b503f7832d379fe0fe
MD5 1917de880fc16f2f23a6bec1f4ebe166
BLAKE2b-256 52a12f46ba3f0b9c0131f81536a137cb7eb531cfd0d4c45aada3c48970753e19

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp314-cp314-musllinux_1_2_x86_64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp314-cp314-musllinux_1_2_aarch64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp314-cp314-musllinux_1_2_aarch64.whl
Algorithm Hash digest
SHA256 451d7c29e066e6aeffc6328b53ec9feb0cd3af826379259746e69e68abed69ef
MD5 6e710fd98dc07896da5cf76f02a1bc58
BLAKE2b-256 8f367dc48982d93cd66cb5c6f36feb307ec74ef19f6baaf503be48a9cff3d1bf

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp314-cp314-musllinux_1_2_aarch64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp314-cp314-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp314-cp314-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl
Algorithm Hash digest
SHA256 14e3a18d7a2a4d226e6a778c85ff946e96602ffc8b5f9b726e5b655f664b32e7
MD5 adca4046872403edbba397675e2077f1
BLAKE2b-256 e397cf56cc945eb17896faf91f173b2c51cb4155e9732408a644e927e9e1dd73

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp314-cp314-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp314-cp314-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp314-cp314-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl
Algorithm Hash digest
SHA256 2dee400273719f3532b614e9fbc11aef8b826dc0c78343cff97eb61ed11840b5
MD5 fa652af11075ca63286338b635429bc0
BLAKE2b-256 0b9a62f40267e86c720945e60e81b5ffeac45f846f6a7354cca814b584320516

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp314-cp314-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp313-cp313-musllinux_1_2_x86_64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp313-cp313-musllinux_1_2_x86_64.whl
Algorithm Hash digest
SHA256 d67ff84eeefb9773e987bd061d91b60143205b897c63aa6a58e83eb3118aaee0
MD5 4efb5b6ee9586b8286cb7e6deba1953d
BLAKE2b-256 e449350cb14d14721b1e5cf5f82f2e3c5c98278e80e4a82fbeeab10f7cffaead

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp313-cp313-musllinux_1_2_x86_64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp313-cp313-musllinux_1_2_aarch64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp313-cp313-musllinux_1_2_aarch64.whl
Algorithm Hash digest
SHA256 f5800da3eae1ef47abae4fe10c4276c257cdaa24dc79a454de0f4ff2cb44266c
MD5 2d7a8e42c294054fa87d199897c32a53
BLAKE2b-256 d9a6becdea23b3c63656ed61d6b555a1bd3b1969ac3959149ca8f42f400e638e

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp313-cp313-musllinux_1_2_aarch64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp313-cp313-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp313-cp313-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl
Algorithm Hash digest
SHA256 87f42450cb4c6751d170b6849f1e1b54adff60419e60ec043244f0218e3a36b4
MD5 54ce0e5bf5cb87de56fe09cbb60a11f2
BLAKE2b-256 0b52bda1ec238e397e28cce6c7ca91af45c5d6c9034936f953c19a5deb830e52

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp313-cp313-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp313-cp313-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp313-cp313-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl
Algorithm Hash digest
SHA256 f8123268e826e799fb9b79c268cad615344d3d7361c894b032ea797542f8afdb
MD5 7346bc1e8029b7aa5b32b27408cbfb4e
BLAKE2b-256 f13c8d470b33ba897a4d2cd3713252a4c5e139cd271d5381a453b2b388d0b46d

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp313-cp313-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp313-cp313-macosx_11_0_arm64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp313-cp313-macosx_11_0_arm64.whl
Algorithm Hash digest
SHA256 30cec4ccfbf99f87feed8425e872e237c40824e6d4f1dcd967401a6c02326a6d
MD5 d17ca359b2487da877e1e92e4cbf7815
BLAKE2b-256 ef57892b4d5732e3a9f4e80fcfee7860c2217eca2833eaadea101d77c4960dec

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp313-cp313-macosx_11_0_arm64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp313-cp313-macosx_10_13_x86_64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp313-cp313-macosx_10_13_x86_64.whl
Algorithm Hash digest
SHA256 30d37633a4b74a7a4a8dd1ae24b68a76f7c7d1d77ba122f655355815c8d25882
MD5 e451cca364645facbd6e6014e4b28aea
BLAKE2b-256 13fc9707e5e41e32cc7ec69a258777a42407665b3c7e1daad0710337cda4dbc5

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp313-cp313-macosx_10_13_x86_64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp312-cp312-musllinux_1_2_x86_64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp312-cp312-musllinux_1_2_x86_64.whl
Algorithm Hash digest
SHA256 6adfc5c794e1bc9c9f4ba14c8896f8f34c24cb782e79e34ab5a9c90258ad4048
MD5 f00c25345a069a912c9b2c334375d87f
BLAKE2b-256 5c01eb9d2c7d6992a17e34f648b21dd4d8e96ad672cb85ac6e0da4b0484a806d

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp312-cp312-musllinux_1_2_x86_64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp312-cp312-musllinux_1_2_aarch64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp312-cp312-musllinux_1_2_aarch64.whl
Algorithm Hash digest
SHA256 84c9018844dd3fa0a31e3caf97948335f7623270887b84459e4e6b3750996cf3
MD5 220ccdccbd27d86a18c2919b9211169b
BLAKE2b-256 db90a9ca7bc93f4f369909109768719161c483794d74b23d43e5acb03ae63a26

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp312-cp312-musllinux_1_2_aarch64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp312-cp312-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp312-cp312-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl
Algorithm Hash digest
SHA256 c09dd797dd5a3b849f13d014a57c6c97c25bb66936a058131451feac488d8a1d
MD5 5802a79e96928c86340037fb084bad37
BLAKE2b-256 28c675f22cccc759ff1e698eac1d2f44ba9970e1735e257eb8cfbb1e333c834e

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp312-cp312-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp312-cp312-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp312-cp312-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl
Algorithm Hash digest
SHA256 90eb2816302d21b449bc253128724079ef63edbe226729544e7fcf9aff52e05b
MD5 bcdc3d02d3668e7070421fd3a2296bcf
BLAKE2b-256 bfd033b110adada5def10ea2c3c2791735c46ab802c2a46815c3165258657b87

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp312-cp312-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp312-cp312-macosx_11_0_arm64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp312-cp312-macosx_11_0_arm64.whl
Algorithm Hash digest
SHA256 e5ccfc62583d931be2737d8204f53ed060e6fc36e042b3ce3d0b9158f9ba6e3a
MD5 22cc68ca599965882f8c761896fa6297
BLAKE2b-256 311895475851f2412b3c8baadfaf6f93d106f97ea7272ce8b2d7631ce459085c

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp312-cp312-macosx_11_0_arm64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp312-cp312-macosx_10_13_x86_64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp312-cp312-macosx_10_13_x86_64.whl
Algorithm Hash digest
SHA256 b7ceed64f1a56c3c9de9886ef4c9649d72a624b458b1b0b44a416390146da43c
MD5 bcc2c0e8acf74182b3c19b0c7d8579c8
BLAKE2b-256 7492e712045452d99d332e15ecdc98478018d31acc1040a831f393b7eb3da4ba

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp312-cp312-macosx_10_13_x86_64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp311-cp311-musllinux_1_2_x86_64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp311-cp311-musllinux_1_2_x86_64.whl
Algorithm Hash digest
SHA256 3362c0516fa8ff697763417fd0b5c7b157f3af4b0b07143eb41da709b4a1f759
MD5 492af5487c5cca19a4dff088e0879b77
BLAKE2b-256 e40e3c558faf1b6eaaa4d766a784707e85550bdd789e8413d7fa6616c801b30d

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp311-cp311-musllinux_1_2_x86_64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp311-cp311-musllinux_1_2_aarch64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp311-cp311-musllinux_1_2_aarch64.whl
Algorithm Hash digest
SHA256 082a7841376aff6b1cb1a7e6faecd6998c7809bda26e51ecfb33c0864ebd4936
MD5 0f59e8fea05228be8c7572216decb54f
BLAKE2b-256 4edc6d6fe993fef5b518f682606e3985ee3a3a6fa711d8273d7db135456760a6

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp311-cp311-musllinux_1_2_aarch64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp311-cp311-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp311-cp311-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl
Algorithm Hash digest
SHA256 9e525b905aeea1b5977c85d9f4342a5cca3a945e5295f839b1b7c50b883f4ced
MD5 c382a46e22eb64b03934373e6da34188
BLAKE2b-256 bc4303f8e01b222db2e7f6a201ec565c5bb67dab8d3454a96551ad48564b452b

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp311-cp311-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp311-cp311-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp311-cp311-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl
Algorithm Hash digest
SHA256 92a7faf63f0643a99fe3d08f36e38b2d8cfcf6ec2180a6e6054c015ab5845548
MD5 330f8f8faf7f9f0efa8ddae961c5a022
BLAKE2b-256 c302cdc42aa0cc4614543be152c154f721f334b72a858d1224b842e8cfe5611d

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp311-cp311-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp311-cp311-macosx_11_0_arm64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp311-cp311-macosx_11_0_arm64.whl
Algorithm Hash digest
SHA256 a24478f66a5ef681c470dc204af651434696190fb5f5f33ee6efa6a195804dad
MD5 86d4da2047d6b07e507b620b4f7c08db
BLAKE2b-256 643b1c565f7d705835ff5517546d4ed4fc0dd09c3f7c767089664698c4f54bea

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp311-cp311-macosx_11_0_arm64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp311-cp311-macosx_10_9_x86_64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp311-cp311-macosx_10_9_x86_64.whl
Algorithm Hash digest
SHA256 651687b7a6e5094478749a8237bec4dd32f1583e765e836cef1516ee3a421f3b
MD5 fb9685eddcf7ce619ac1b1a5c4aa781f
BLAKE2b-256 ea7c8a6b4afd6e473c2fcc5f40cf0939a11c4b66d250012329cf6bc4437f968d

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp311-cp311-macosx_10_9_x86_64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp310-cp310-musllinux_1_2_x86_64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp310-cp310-musllinux_1_2_x86_64.whl
Algorithm Hash digest
SHA256 16bfa6d80a54d21b6cd96508576d93b83092ba0ac8be6e91a74a5d99f4012a56
MD5 bc0f576ba0ed99101d3687906a63be48
BLAKE2b-256 04c714f73303675bbe9a2c6c2c56999ccfe75555d829ff5623a35327f88a2f89

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp310-cp310-musllinux_1_2_x86_64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp310-cp310-musllinux_1_2_aarch64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp310-cp310-musllinux_1_2_aarch64.whl
Algorithm Hash digest
SHA256 3c9d7c5290af2cc3777599f14778de7a12e5b67ac48b62a39a0db048be5f8dd0
MD5 117af41b9d459d19d9490e9147131348
BLAKE2b-256 b7e06a340d0c8c255b9f07537179f5e92bb94e97b88ad2b8681b1e36440bd978

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp310-cp310-musllinux_1_2_aarch64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp310-cp310-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp310-cp310-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl
Algorithm Hash digest
SHA256 5fa1dd4c38819a2d1f3a6ff0a1afe4cc55ada75009e400a369c4228b1964ea96
MD5 240afa3f25879c73d7710df541dc5beb
BLAKE2b-256 a8bca9ed115e04c5acb38e3242ecd69ee8a7cb64a18c97cab0d1f5e60b3d3b19

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp310-cp310-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp310-cp310-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp310-cp310-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl
Algorithm Hash digest
SHA256 6c5f8b701663e1fe6f1c11d830d61d59a538fd50b46a92fea53fac8e9f10f8d7
MD5 f7439f0ce950008743de0b0a51ed518e
BLAKE2b-256 0bf7e648894a6c77cc1a6b509d218b6b507794511070819a9182c2ed52019ae9

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp310-cp310-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp310-cp310-macosx_11_0_arm64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp310-cp310-macosx_11_0_arm64.whl
Algorithm Hash digest
SHA256 3692473cf3a4979f916fb1c0395258994383f6c5fd0f8b6e98b2930bd6a6a9a9
MD5 aa8fb03498bd26731040db985c1c2721
BLAKE2b-256 d3c49505a395772d597a9dc522b5a39e9867de43858b7ea7231cff632f2d5e47

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp310-cp310-macosx_11_0_arm64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file pybwa-2.3.2-cp310-cp310-macosx_10_9_x86_64.whl.

File metadata

File hashes

Hashes for pybwa-2.3.2-cp310-cp310-macosx_10_9_x86_64.whl
Algorithm Hash digest
SHA256 c5e3241937150305ba05fc6c54e710c20cb83fd341d45c827a0e6d0f2e1c419a
MD5 2d163dfa799aa84dc3a0fde33fc966ed
BLAKE2b-256 9050320502d8cf52abe04a7b83ba848454cb7a222b5b71e090dc08651789c346

See more details on using hashes here.

Provenance

The following attestation bundles were made for pybwa-2.3.2-cp310-cp310-macosx_10_9_x86_64.whl:

Publisher: publish_pybwa.yml on fulcrumgenomics/pybwa

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

Release history Release notifications | RSS feed

This release

2.3.2 This release

29 files

2.3.1

29 files

2.3.0

29 files

2.2.0

25 files

2.1.0

25 files

2.0.1

25 files

2.0.0

25 files

1.6.0

25 files

1.5.2

25 files

1.5.1

25 files

1.5.0

25 files

1.4.8

25 files

1.4.7

25 files

1.4.6

25 files

1.4.5

25 files

1.4.4

23 files

1.4.3

13 files

1.4.0

13 files

1.3.4

13 files

1.3.3

13 files

1.3.2

13 files

1.3.1

13 files

1.3.0

13 files

1.2.0

13 files

1.1.3

13 files

1.1.2

13 files

1.1.1

13 files

1.1.0

13 files

1.0.4

13 files

1.0.3

13 files

1.0.2

13 files

1.0.1

13 files

1.0.0

5 files

0.2.4

1 file

0.0.1

5 files

Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page