pygenomecomp 0.2.0

A tool to create circular comparison plots for multiple genome assemblies against a reference.

PyGenomeComp

A Python command-line tool to visualize whole-genome comparisons. pygenomecomp aligns one or more query genomes against a reference genome and generates a circular plot showing sequence identity, with an optional track for reference genome annotations.

Key Features

• Aligns multiple query genomes to a reference using BLAST+.
• Parses GFF3 and GenBank files to display reference annotations.
• Generates a clear, publication-quality SVG circular plot.
• Customizable alignment filters (min. identity, min. length, e-value).
• NEW: Optionally display gene names as text labels on the plot.

---

Installation

Install instructions here...

---

Usage

Create the following four files in a new directory:

reference.fasta

>ref_contig_1
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAAC

query1.fasta

>query_A
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAAT

query2.fasta

>query_B
TAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAAC

query3.fasta

>query_C
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAAC

annotations.gff3

##gff-version 3
ref_contig_1	Prokka	gene	350	450	.	+	.	ID=gene01;Name=ABC_transporter
ref_contig_1	Prokka	CDS	350	450	.	+	0	ID=cds01;Parent=gene01;product=ATP-binding cassette transporter
ref_contig_1	Prokka	rRNA	120	220	.	-	.	ID=rrna01;product=16S ribosomal RNA

2. Run the Tool

Open your terminal in the directory containing these files and run the following command:

pygenomecomp \
  --reference reference.fasta \
  --queries query1.fasta query2.fasta query3.fasta \
  --annotations annotations.gff3 \
  --output_dir my_comparison_results

3. Show gene names on the plot (optional)

To display gene names as text labels on the annotation ring of the plot, add the --show_gene_names option:

pygenomecomp \
  --reference reference.fasta \
  --queries query1.fasta query2.fasta query3.fasta \
  --annotations annotations.gff3 \
  --output_dir my_comparison_results \
  --show_gene_names

4. Check the Output

A new directory named my_comparison_results will be created. Inside, you will find:

• Intermediate BLAST database and result files.
• The final visualization: comparison_plot.svg.

Open comparison_plot.svg in a web browser or vector graphics editor. It will show a central reference ring with annotation features, and two or more outer rings corresponding to the query sequences, with arcs colored by sequence identity.

If --show_gene_names is set, gene names from the annotation file will be rendered as labels near their corresponding arcs.

---

Command-Line Usage

$ pygenomecomp --help
usage: pygenomecomp [-h] -r REFERENCE -q QUERIES [QUERIES ...]
                    [--annotations ANNOTATIONS] [-o OUTPUT_DIR]
                    [--plot_file PLOT_FILE] [--min_identity MIN_IDENTITY]
                    [--min_length MIN_LENGTH] [--evalue EVALUE]
                    [--show_gene_names]

Genome Assembly Comparison Tool with Annotation Ring.

options:
  -h, --help            show this help message and exit
  -r REFERENCE, --reference REFERENCE
                        Reference genome assembly in FASTA format.
  -q QUERIES [QUERIES ...], --queries QUERIES [QUERIES ...]
                        One or more query genome assemblies in FASTA format.
  --annotations ANNOTATIONS
                        Optional: Reference genome annotation file (GFF3 or
                        GBFF/GenBank format).
  -o OUTPUT_DIR, --output_dir OUTPUT_DIR
                        Output directory for BLAST results and plot.
  --plot_file PLOT_FILE
                        Output SVG plot file name.
  --min_identity MIN_IDENTITY
                        Minimum BLAST percentage identity.
  --min_length MIN_LENGTH
                        Minimum BLAST alignment length.
  --evalue EVALUE       BLAST e-value cutoff.
  --show_gene_names     Show gene names as text labels on the plot annotation ring.

License

This project is licensed under the MIT License