HGVS variant name parsing and generation with SV (structural variant) support
Project description
HGVS variant name parsing and generation
The Human Genome Variation Society (HGVS) promotes the discovery and sharing of genetic variation in the human population. As part of facilitating variant sharing, the society has produced a series of recommendations for how to name and refer to variants within research publications and clinical settings. A compilation of these recommendations is available on their website.
This library provides a simple Python API for parsing, formatting, and normalizing HGVS names. Surprisingly, there are many non-trivial steps necessary in handling HGVS names and therefore there is a need for well tested libraries that encapsulate these steps.
HGVS name example
In most next-generation sequencing applications, variants are first
discovered and described in terms of their genomic coordinates such as
chromosome 7, position 117,199,563 with reference allele G and
alternative allele T. According to the HGVS standard, we can
describe this variant as NC_000007.13:g.117199563G>T. The first
part of the name is a RefSeq ID NC_000007.13 for chromosome 7
version 13. The g. denotes that this is a variant described in
genomic (i.e. chromosomal) coordinates. Lastly, the chromosomal position,
reference allele, and alternative allele are indicated. For simple
single nucleotide changes the > character is used.
More commonly, a variant will be described using a cDNA or protein
style HGVS name. In the example above, the variant in cDNA style is
named NM_000492.3:c.1438G>T. Here again, the first part of the name
refers to a RefSeq sequence, this time mRNA transcript NM_000492
version 3. Optionally, the gene name can also be given as
NM_000492.3(CFTR). The c. indicates that this is a cDNA name, and
the coordinate indicates that this mutation occurs at position 1438
along the coding portion of the spliced transcript (i.e. position 1 is
the first base of ATG translation start codon). Briefly, the
protein style of the variant name is NP_000483.3:p.Gly480Cys which
indicates the change in amino-acid coordinates (480) along an
amino-acid sequence (NP_000483.3) and gives the reference and
alternative amino-acid alleles (Gly and Cys, respectively).
The standard also specifies custom name formats for many mutation
categories such as insertions (NM_000492.3:c.1438_1439insA),
deletions (NM_000492.3:c.1438_1440delGGT),
duplications (NM_000492.3:c.1438_1440dupGGT), and several
other more complex genomic rearrangements.
While many of these names appear to be simple to parse or generate,
there are many corner cases, especially with cDNA HGVS names. For
example, variants before the start codon should have negative cDNA
coordinates (NM_000492.3:c.-4G>C), and variants after the stop codon
also have their own format (NM_000492.3:c.*33C>T). Variants within
introns are indicated by the closest exonic base with an additional
genomic offset such as NM_000492.3:4243-20A>G (the variant is 20
bases in the 5' direction of the cDNA coordinate 4243). Lastly, all
coordinates and alleles are specified on the strand of the
transcript. This library properly handles all logic necessary to
convert genomic coordinates to and from HGVS cDNA coordinates.
Another important consideration of any library that handles HGVS names
is variant normalization. The HGVS standard aims to provide "uniform
and unequivocal" description of variants. Namely, two people
discovering a variant should be able to arrive at the same name for
it. Such a property is very useful for checking whether a variant has
been seen before and connecting all known relevant information. For
SNPs, this property is fairly easy to achieve. However, for
insertions and deletions (indels) near repetitive regions, many indels
are equivalent (e.g. it doesn't matter which AT in a run of
ATATATAT was deleted). The VCF file format has chosen to uniquely
specify such indels by using the most left-aligned genomic coordinate.
Therefore, compliant variant callers that output VCF will have applied
this normalization. The HGVS standard also specifies a normalization
for such indels. However, it states that indels should use the most 3'
position in a transcript. For genes on the positive strand, this is
the opposite direction specified by VCF. This library properly
implements both kinds of variant normalization and allows easy
conversion between HGVS and VCF style variants. It also handles
many other cases of normalization (e.g. the HGVS standard recommends
indicating an insertion with the dup notation instead of ins
if it can be represented as a tandem duplication).
Example usage
Below is a minimal example of parsing and formatting HGVS names. In
addition to the name itself, two other pieces of information are
needed: the genome sequence (needed for normalization), and the
transcript model or a callback for fetching the transcript model
(needed for transcript coordinate calculations). This library makes
as few assumptions as possible about how this external data is stored.
In this example, the genome sequence is read using the pyfaidx library
and transcripts are read from a RefSeqGenes flat-file using methods
provided by hgvsv.
import pyhgvsv as hgvsv
import pyhgvsv.utils as hgvsv_utils
from pyfaidx import Fasta
# Read genome sequence using pyfaidx.
# !!! ALL BELOW EXAMPLES FOR 'NM_000352.3:c.215A>G' USE hg19. RESULTS WILL VARY. !!!
genome = Fasta('/tmp/hg38.fa')
# Read RefSeq transcripts into a python dict.
with open('hgvs/data/genes.refGene') as infile:
transcripts = hgvs_utils.read_transcripts(infile)
# Provide a callback for fetching a transcript by its name.
def get_transcript(name):
return transcripts.get(name)
# Parse the HGVS name into genomic coordinates and alleles.
chrom, offset, ref, alt = hgvs.parse_hgvs_name(
'NM_000352.3:c.215A>G', genome, get_transcript=get_transcript)
# Returns variant in VCF style: ('chr11', 17496508, 'T', 'C')
# Notice that since the transcript is on the negative strand, the alleles
# are reverse complemented during conversion.
# Format an HGVS name.
chrom, offset, ref, alt = ('chr11', 17496508, 'T', 'C')
transcript = get_transcript('NM_000352.3')
hgvs_name = hgvs.format_hgvs_name(
chrom, offset, ref, alt, genome, transcript)
# Returns 'NM_000352.3(ABCC8):c.215A>G'
# Format an HGVS name for a structural variant (deletion).
chrom, offset, ref, alt, sv_length = ('chrY', 24861625, '', '', -4780)
transcript = get_transcript('NM_001388484.1')
hgvs_name = hgvsv.format_hgvs_name(
chrom, offset, ref, alt, genome, transcript)
# Returns 'NM_001388484.1(DAZ4):c.1210-436_1354-437del4780'
# Format an HGVS name for a structural variant (insertion).
chrom, offset, ref, alt, sv_length = ('chr17', 8141778, '', 'TTCTCCCCCCTTGAACTTGAGCTCAATTC', 29)
transcript = get_transcript('NM_002616.3')
hgvs_name = hgvsv.format_hgvs_name(
chrom, offset, ref, alt, genome, transcript)
# Returns 'NM_002616.3(PER1):c.3600+26_3600+27ins29'
The hgvsv library can also perform just the parsing step and provide
a parse tree of the HGVS name.
import pyhgvs as hgvs
hgvs_name = hgvs.HGVSName('NM_000352.3:c.215-10A>G')
# fields of the HGVS name are available as attributes:
#
# hgvs_name.transcript = 'NM_000352.3'
# hgvs_name.kind = 'c'
# hgvs_name.mutation_type = '>'
# hgvs_name.cdna_start = hgvs.CDNACoord(215, -10)
# hgvs_name.cdna_end = hgvs.CDNACoord(215, -10)
# hgvs_name.ref_allele = 'A'
# hgvs_name.alt_allele = 'G'
Install
This library can be installed using the setup.py file as follows:
python setup.py install
Tests
Test cases can be run by running
python setup.py nosetests
Requirements
This library requires at least Python 2.6, but otherwise has no external dependencies.
The library does assume that genome sequence is available through a pyfaidx
compatible Fasta object. For an example of writing a wrapper for
a different genome sequence back-end, see
hgvs.tests.genome.MockGenome.
Project details
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file pyhgvsv-0.1.tar.gz.
File metadata
- Download URL: pyhgvsv-0.1.tar.gz
- Upload date:
- Size: 24.5 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/5.0.0 CPython/3.10.12
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
d9405e157590e56eaacccf361f3fd6a66b52198b42cdffbc3e998975b1876c31
|
|
| MD5 |
cdc69ad070bf10cfb7cb42e5669ca4dc
|
|
| BLAKE2b-256 |
f005b3f93b33926d57b90314ca5ca494c052f8f6361ea5d3c8110b137afa4f0c
|
File details
Details for the file pyhgvsv-0.1-py3-none-any.whl.
File metadata
- Download URL: pyhgvsv-0.1-py3-none-any.whl
- Upload date:
- Size: 22.4 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/5.0.0 CPython/3.10.12
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
b5ca78ef66f4d63102ea4623a7987d8e8a7b0e4e0c5601371240135164b9b53b
|
|
| MD5 |
15ddf2cc47d1d8af3dc9b4632ea34ced
|
|
| BLAKE2b-256 |
c04fa1b13d9e8f76e91315796cd8cd70cc6777ca0d11c3761e62d6bf2b093e65
|