Skip to main content

find antimcirobial resistance genes on genomes

Project description

ResBlaster

PYPI

 ____           ____  _           _
|  _ \ ___  ___| __ )| | __ _ ___| |_ ___ _ __
| |_) / _ \/ __|  _ \| |/ _` / __| __/ _ \ '__|
|  _ <  __/\__ \ |_) | | (_| \__ \ ||  __/ |
|_| \_\___||___/____/|_|\__,_|___/\__\___|_|

Installation

pip3 install ResBlaster

Dependency

  • BLAST+ >2.7.0

  • cvmblaster (v0.4.1)

you should add BLAST in your PATH

Blast installation

Windows

Following this tutorial: Add blast into your windows PATH

Linux/Mac

The easyest way to install blast is:

conda install -c bioconda blast

Usage

1. Initialize reference database

After finish installation, you should first initialize the reference database using following command

ResBlaster -init
Usage: ResBlaster -i <genome assemble directory> -db <reference database> -o <output_directory> -minid 90 -mincov 60 -t 4


optional arguments:
  -h, --help      show this help message and exit
  -i I            <input_path>: the PATH to the directory of assembled genome files
  -o O            <output_directory>: output PATH
  -db DB          <database>: resfinder or others, You colud check database list using -list parameter
  -minid MINID    <minimum threshold of identity>, default=90
  -mincov MINCOV  <minimum threshold of coverage>, default=60
  -list           <show database list>
  -init           <initialize the reference database>
  -t T            <number of threads>: default=8
  -store_arg_seq  save the nucleotide and amino acid sequence of find genes on genome
  -v, --version   Display version

2. Making your own database

Let's say you want to make your own database called owndb. All you need is a FASTA file of nucleotide sequences, say owndb.fsa(note: the fasta file must end with .fsa). Ideally the sequence IDs would have the format >GENE___ID___ACC___CATEGORY where GENE is the name of GENE, ID is the allele ID of GENE, ACC is an accession number of the sequence source, CATEGORY is the CATEGORY of this GENE belongs to.

**Your final **owndb.fsa should like this:

>blaOXA-62___1___AY423074___Beta-lactam
ATGAATACGATAATCTCTCGCCGGTGGCGTGCCGGCCTGTGGCGGCGGCTGGTCGGCGCG
GTCGTCTTGCCCGCAACGCTCGCCGCCACCCCTGCGGCCTATGCGGCCGACGTGCCGAAA
GCCGCGTTGGGGCGCATCACCGAGCGCGCCGACTGGGGCAAGCTGTTCGCCGCGGAGGGC
GTGAAGGGCACGATCGTGGTGCTCGACGCACGCACGCAAACCTATCAGGCCTACGACGCC
GCACGTGCCGAGAAGCGCATGTCGCCGGCGTCGACCTACAAGATATTCAACAGCCTGCTG
GCGCTCGACTCCGGGGCGCTGGACAACGAACGCGCGATCATTCCCTGGGATGGCAAGCCG
CGACGCATCAAGAACTGGAACGCGGCGATGGACCTGAGGACCGCGTTTCGCGTGTCATGC
CTGCCCTGCTATCAGGTCGTCTCGCACAAGATCGGGCGCCGGTACGCGCAGGCGAAGCTG
AACGAGGTCGGGTATGGCAACCGCACCATTGGCGGCGCGCCGGACGCCTATTGGGTCGAC
GACAGTCTGCAGATTTCGGCGCGTGAGCAGGTGGACTTCGTGCAGCGTCTCGCGCGTGGC
ACGTTGCCGTTCTCTGCGCGCTCGCAGGACATCGTGCGCCAGATGTCGATCGTCGAAGCC
ACGCCGGACTATGTGCTTCACGGCAAGACGGGTTGGTTCGTCGACAAGAAGCCCGATATC
GGCTGGTGGGTAGGGTGGATCGAGCGCGACGGCAACATCACCAGCGTCGCGATCAACATC
GACATGCTGTCGGAGGCGGACGCCCCGAAACGGGCACGCATCGTGAAGGCGGTGCTGAAG
GACCTGAAGCTGATCTGA

**Run following command will add **owndb.fsa to blast database

% ResBlaster -updatedb owndb.fsa

3. Features under development

Following database are currently under development and will be available soon:

Database Description
vfdb_core The core dataset of vfdb
vfdb_full The full database of vfdb
ncbi Bacterial Antimicrobial Resistance Reference Gene Database from NCBI
resfinder ARGs from ResFinder
ssuis_sero The serotype database for Streptococcus suis
hps The serotype database for Haemophilus parasuis
lmo Listeria monocytogenes relevant genes from Pasteur Institute
ESBL ESBL genes

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

ResBlaster-0.4.0.tar.gz (12.7 MB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

ResBlaster-0.4.0-py3-none-any.whl (14.0 MB view details)

Uploaded Python 3

File details

Details for the file ResBlaster-0.4.0.tar.gz.

File metadata

  • Download URL: ResBlaster-0.4.0.tar.gz
  • Upload date:
  • Size: 12.7 MB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.8.0 pkginfo/1.8.2 readme-renderer/32.0 requests/2.31.0 requests-toolbelt/0.9.1 urllib3/1.26.7 tqdm/4.65.0 importlib-metadata/4.10.1 keyring/23.5.0 rfc3986/2.0.0 colorama/0.4.6 CPython/3.9.8

File hashes

Hashes for ResBlaster-0.4.0.tar.gz
Algorithm Hash digest
SHA256 760109efd2bed7394d21093312ffe80c17e108433624f584efcadf4f76a8773a
MD5 f7863b76065b72c3afd32d3411cccbd5
BLAKE2b-256 e30c27af11f899ec23b1a143d53bfc596d21a79e0581dea1c674e6e2b92a5610

See more details on using hashes here.

File details

Details for the file ResBlaster-0.4.0-py3-none-any.whl.

File metadata

  • Download URL: ResBlaster-0.4.0-py3-none-any.whl
  • Upload date:
  • Size: 14.0 MB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.8.0 pkginfo/1.8.2 readme-renderer/32.0 requests/2.31.0 requests-toolbelt/0.9.1 urllib3/1.26.7 tqdm/4.65.0 importlib-metadata/4.10.1 keyring/23.5.0 rfc3986/2.0.0 colorama/0.4.6 CPython/3.9.8

File hashes

Hashes for ResBlaster-0.4.0-py3-none-any.whl
Algorithm Hash digest
SHA256 c9adc7deb968332a039683e7b5d722e382a460267b180441d4302438e5bfd1bb
MD5 a5acfbc5aa887a7e9ce18c94e314f6a6
BLAKE2b-256 44b6bbff2a80d95e737d39ad5e87021ff6d4244b3bfd59e42e744dcb32813413

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page