riboclette 0.1.1

No project description provided

Riboclette pip Package

Riboclette is a Python package designed for analyzing ribosome footprints and calculating attributions for genes under 6 nutrient-deprivation conditions. It leverages a XLNet-based model to provide predictions and insights into translation elongation dynamics.

---

Features

• Predict ribosome footprints (RFP) for genes under different deprivation conditions.
• Compute attributions for genes to understand the impact of specific codons.

---

Installation

Install the package using pip:

pip install riboclette

Ensure you have the required dependencies installed:

• numpy
• torch
• transformers
• captum
• tqdm

For GPU support, make sure that PyTorch is installed with CUDA.

---

Usage

1. Predict Ribosome Footprints (RFP)

The predictRFP function predicts ribosome footprints for a given nucleotide sequence and condition.

from riboclette import predictRFP

sequence = "ATGCGTACGTAGCTAGCTAGC"
condition = "ILE"  # Options: 'CTRL', 'ILE', 'LEU', 'LEU_ILE', 'LEU_ILE_VAL', 'VAL'

ctrl_rfp, dd_rfp, dc_rfp = predictRFP(sequence, condition)
print("Control RFP:", ctrl_rfp)
print("DD RFP:", dd_rfp)
print("Deprivation Condition RFP:", dc_rfp)

2. Compute Attributions

The getAttr function calculates attributions for a nucleotide sequence under a specific condition and head.

from riboclette import getAttr

sequence = "ATGCGTACGTAGCTAGCTAGC"
condition = "ILE"  # Options: 'CTRL', 'ILE', 'LEU', 'LEU_ILE', 'LEU_ILE_VAL', 'VAL'
head = "CTRL"  # Options: 'CTRL', 'DD'

attr = getAttr(sequence, condition, head)
print("Attributions:", attr)

---

Input and Output Details

Input

• Sequence: A string of nucleotide bases (e.g., "ATGCGTACGTAGCTAGCTAGC").
• Condition: One of the following:
  • 'CTRL'
  • 'ILE'
  • 'LEU'
  • 'LEU_ILE'
  • 'LEU_ILE_VAL'
  • 'VAL'
• Head (for getAttr): 'CTRL' or 'DD'.

Output

• predictRFP: Returns three arrays:
  • ctrl_rfp: Control RFP values.
  • dd_rfp: DD RFP values.
  • dc_rfp: Deprivation Condition RFP values.
• getAttr: Returns an array of attributions for the given sequence and head.

---

Model Details

We employ the Riboclette Tr-Pl model for this package, and it is automatically loaded for all the computations.

---

License

This package is distributed under the MIT License. See the LICENSE file for more details.

---

Contact

For questions or issues, please contact the maintainers at [[e-mail],[e-mail]].