Skip to main content

No project description provided

Project description

Righor-py

Companion to righor, to publish the python package. Install with pip install righor.

Load a model:

import righor
import matplotlib.pyplot as plt
import seaborn
import pandas as pd
from tqdm.notebook import tqdm
from collections import Counter
import numpy as np


igor_model = righor.load_model("human", "trb")

# alternatively, you can load a model from igor files
# igor_model = righor.load_model_from_files(params.txt, marginals.txt, anchor_v.csv, anchor_j.csv)

Generate sequences fast:

# Create a generator object
generator = igor_model.generator(seed=42) # or igor_model.generator() to run it without a seed

# Generate 10'000 functional sequences (not out-of-frame, no stop codons, right boundaries)
for _ in tqdm(range(10000)):
    # generate_without_errors ignore Igor error model, use "generate" if this is needed
    sequence = generator.generate_without_errors(functional=True)
    if "IGH" in sequence.cdr3_aa:
        print("TRB CDR3 containing \"IGH\":", sequence.cdr3_aa)

# Generate one sequence with a particular V/J genes family
V_genes = righor.genes_matching("TRBV5", igor_model) # return all the V genes that match TRBV5
J_genes = righor.genes_matching("TRBJ", igor_model) # all the J genes
generator = igor_model.generator(seed=42, available_v=V_genes, available_j=J_genes)
generation_result = generator.generate_without_errors(functional=True)
print("Result:")
print(generation_result)
print("Explicit recombination event:")
print(generation_result.recombination_event)

Evaluate a given sequence:

my_sequence = "ACCCTCCAGTCTGCCAGGCCCTCACATACCTCTCAGTACCTCTGTGCCAGCAGTGAGGACAGGGACGTCACTGAAGCTTTCTTTGGACAAGGCACC"

# first align the sequence
align_params = righor.AlignmentParameters() # default alignment parameters
aligned_sequence = igor_model.align_sequence(my_sequence, align_params)

# we can also align a sequence from a CDR3 and a list of V-genes and J-genes (much faster)
# v_genes = righor.genes_matching("TRBV1", igor_model)
# j_genes = righor.genes_matching("TRBJ1", igor_model)
# igor_model.align_cdr3('TGTGTGAGAGATATTGTAGTAGTACCAGCTGCTAACCGCTTTCCTTCTTACTACTACTACTACTACATGGACGTCTGG', v_genes, j_genes)

# then evaluate it
infer_params = righor.InferenceParameters() # default inference parameters
result_inference = igor_model.evaluate(aligned_sequence, infer_params)

# Most likely scenario
best_event = result_inference.best_event

print(f"Probability that this specific event chain created the sequence: {best_event.likelihood / result_inference.likelihood:.2f}.")
print(f"Reconstructed sequence (without errors):", best_event.reconstructed_sequence)
print(f"Pgen: {result_inference.pgen:.1e}")

Infer a model:

# here we just generate the sequences needed
generator = igor_model.generator()
example_seq = generator.generate(False)
sequences = [generator.generate(False).full_seq for _ in range(1000)]

# define parameters for the alignment and the inference
align_params = righor.AlignmentParameters()
align_params.left_v_cutoff = 40
infer_params = righor.InferenceParameters()

# generate an uniform model as a starting point
# (it's generally *much* faster to start from an already inferred model)
model = igor_model.copy()
model.p_ins_vd = np.ones(model.p_ins_vd.shape)
model.error_rate = 0

# align multiple sequences at once
aligned_sequences = model.align_all_sequences(sequences, align_params)

# multiple round of expectation-maximization to infer the model
models = {}
model = igor_model.uniform()
model.error_rate = 0
models[0] = model
for ii in tqdm(range(35)):
    models[ii+1] = models[ii].copy()
    models[ii+1].infer(aligned_sequences, infer_params)

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

righor-0.2.1.tar.gz (1.4 MB view hashes)

Uploaded Source

Built Distribution

righor-0.2.1-cp310-cp310-manylinux_2_31_x86_64.whl (1.7 MB view hashes)

Uploaded CPython 3.10 manylinux: glibc 2.31+ x86-64

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page