Skip to main content

RNAPy — Unified RNA Analysis Toolkit

RNAPy is a unified Python toolkit that wraps several powerful RNA models with a consistent, easy-to-use API. It currently integrates:

  • RNA-FM for sequence embeddings and 2D secondary structure prediction
  • RhoFold for 3D structure prediction
  • RiboDiffusion for inverse folding (sequence generation from structure)
  • RhoDesign for inverse folding (structure-to-sequence, optional 2D guidance)
  • RNA-MSM for MSA-based embeddings, attention, consensus, and conservation

Key Features

  • Consistent high-level API via RNAToolkit
  • Extract sequence embeddings (RNA-FM, mRNA-FM)
  • 2D structure prediction (RNA-FM)
  • 3D structure prediction (RhoFold)
  • Inverse folding (RiboDiffusion, RhoDesign)
  • MSA analysis and features (RNA-MSM: embeddings, attention, consensus, conservation)

Project Structure

RNAPy
├── rnapy/                    # Library source
│   ├── core/                 # Base classes, factory, config, exceptions
│   ├── providers/            # Model providers (rna_fm/mrna_fm, rhofold, RiboDiffusion, rhodesign, rna_msm)
│   ├── interfaces/           # Public interfaces
│   └── utils/                # Utilities
├── configs/                  # Global and model configs (YAML)
├── demos/                    # Ready-to-run examples
│   ├── models/               # Put pretrained weights here
│   ├── results/              # Default output location for demos
│   └── demo_*.py             # Demo scripts
├── requirements.txt
├── setup.py
└── README.md

Installation

Recommended: Python 3.12+ and a recent PyTorch build compatible with your CPU/GPU.

pip install rnapy --extra-index-url  https://download.pytorch.org/whl/cpu 

Documentation

  • Toolkit usage guide: docs/RNAToolkit_Usage_Guide.md

Model Weights

  • You can download pretrained weights from the original repositories which will be mentioned in the Acknowledgements section.
  • Or you can find weights used in RNAPy on Hugging Face: https://huggingface.co/Linorman616/rnapy_models/
  • Actually if you don't provide model-path when loading a model, RNAPy will try to download the weights from this repo automatically.

Quick Start

1) RNA-FM (2D structure + embeddings)

from rnapy import RNAToolkit

sequence = "AGAUAGUCGUGGGUUCCCUUUCUGGAGGGAGAGGGAAUUCCACGUUGACCGGGGGAACCGGCCAGGCCCGGAAGGGAGCAACCGUGCCCGGCUAUC"

# Initialize
toolkit = RNAToolkit(device="cpu")

# Load model (choose one)
toolkit.load_model("rna-fm", "./models/RNA-FM_pretrained.pth")

# 2D structure prediction
result = toolkit.predict_structure(
    sequence,
    structure_type="2d",
    model="rna-fm",
    save_dir="./results/rna_fm/demo.ct",
)

# Embeddings
embeddings = toolkit.extract_embeddings(
    sequence,
    model="rna-fm",
    save_dir="./results/rna_fm/embeddings.npy",
)

print(result.get("secondary_structure"))
print(result.get("confidence_scores"))

2) RhoFold (3D structure prediction)

from rnapy import RNAToolkit

sequence = "GGAUCCCGCGCCCCUUUCUCCCCGGUGAUCCCGCGAGCCCCGGUAAGGCCGGGUCC"

toolkit = RNAToolkit(device="cpu")

# Load RhoFold
toolkit.load_model("rhofold", "./models/RhoFold_pretrained.pt")

# Predict 3D
result = toolkit.predict_structure(
    sequence,
    structure_type="3d",
    model="rhofold",
    save_dir="./results/rhofold",
    relax_steps=500,
)

pdb_file = result.get("structure_3d_refined", result.get("structure_3d_unrelaxed"))
print("3D structure:", pdb_file)

3) RiboDiffusion (inverse folding from PDB)

from rnapy import RNAToolkit

structure_file = "./input/R1107.pdb"

toolkit = RNAToolkit(device="cpu")

# Load RiboDiffusion
toolkit.load_model("ribodiffusion", "./models/exp_inf.pth")

# Generate sequences from structure
result = toolkit.generate_sequences_from_structure(
    structure_file=structure_file,
    model="ribodiffusion",
    n_samples=2,
    sampling_steps=100,
    cond_scale=0.5,
    dynamic_threshold=True,
    save_dir="./results/ribodiffusion",
)

print("Generated count:", result.get("sequence_count", 0))
print("Output dir:", result.get("output_directory"))

4) RhoDesign (inverse folding with optional 2D guidance)

from rnapy import RNAToolkit

pdb_path = "./input/2zh6_B.pdb"
ss_path = "./input/2zh6_B.npy"  # optional numpy file with secondary-structure/contact info

toolkit = RNAToolkit(device="cpu")

# Load RhoDesign (with-2D variant checkpoint)
toolkit.load_model("rhodesign", "./models/ss_apexp_best.pth")

# Generate one sequence from structure (RhoDesign samples one sequence per call)
res = toolkit.generate_sequences_from_structure(
    structure_file=pdb_path,
    model="rhodesign",
    secondary_structure_file=ss_path,  # omit or set None to run without 2D guidance
    save_dir="./results/rhodesign"
)

print("Predicted sequence:", res["sequences"][0])
print("Recovery rate:", res.get("quality_metrics", {}).get("sequence_recovery_rate"))
print("FASTA:", res.get("files", {}).get("fasta_files", [None])[0])

5) RNA-MSM (MSA features, consensus, conservation)

from rnapy import RNAToolkit

# Initialize
toolkit = RNAToolkit(device="cpu")

# Load RNA-MSM
toolkit.load_model("rna-msm", "./models/RNA_MSM_pretrained_weights.pt")

# Prepare an example MSA (aligned sequences)
msa_sequences = [
    "AUGGCGAUUUUAUUUACCGCAGUCGUUACCAACAUACUCGACUUUAAAUGCC",
    "AUGGCAAUUUUAUUUACCGCAGUCGUUACCAACAUACUCGACUUUAAAUGCC",
    "AUGGCGAUUUCAUUUACCGCAGUCGUUACCAACAUACUCGACUUUAAAUGCC",
    "AUGGCGAUUUUAUUUACCGCAGUCGUUACCAGCAUACUCGACUUUAAAUGCC",
]

# Extract embeddings (per-position, last layer by default)
features = toolkit.extract_msa_features(
    msa_sequences,
    feature_type="embeddings",
    model="rna-msm",
    save_dir="./results/rna_msm",
)

# Analyze MSA for consensus and conservation
msa_result = toolkit.analyze_msa(
    msa_sequences,
    model="rna-msm",
    extract_consensus=True,
    extract_conservation=True,
    save_dir="./results/rna_msm",
)

print("Consensus:", msa_result.get("consensus_sequence"))
print("Conservation (first 10):", (msa_result.get("conservation_scores") or [])[:10])

Evaluation Metrics

RNAPy ships with common structural evaluation metrics, available via both the Python API and the CLI.

LDDT (Local Distance Difference Test)

  • Python:
from rnapy.toolkit import RNAToolkit

toolkit = RNAToolkit(device="cpu")
res = toolkit.calculate_lddt(
    reference_structure="./demos/input/2zh6_B.pdb",
    predicted_structure="./demos/input/R1107.pdb",
    radius=15.0,
    distance_thresholds=(0.5, 1.0, 2.0, 4.0),
    return_column_scores=True,
)
print(res["lddt"])            # Global LDDT
print(res.get("columns", [])[:5])  # Optional: first 5 per-residue column scores
  • CLI:
rnapy metric lddt \
  --reference ./demos/input/2zh6_B.pdb \
  --predicted ./demos/input/R1107.pdb \
  --radius 15.0 \
  --thresholds 0.5,1.0,2.0,4.0 \
  --return-column-scores

Example script: demos/demo_lddt.py

RMSD (Root Mean Square Deviation)

  • Python:
from rnapy.toolkit import RNAToolkit

toolkit = RNAToolkit()
rmsd = toolkit.calculate_rmsd(
    "./demos/input/rmsd_tests/resources/ci2_1.pdb",
    "./demos/input/rmsd_tests/resources/ci2_2.pdb",
    file_format="pdb",
)
print("RMSD:", rmsd)
  • CLI (common flags only; see rnapy metric rmsd --help for details):
rnapy metric rmsd \
  --file1 ./demos/input/rmsd_tests/resources/ci2_1.pdb \
  --file2 ./demos/input/rmsd_tests/resources/ci2_2.pdb \
  --file-format pdb \
  --rotation kabsch

Other options include: --reorder, --reorder-method inertia-hungarian, --use-reflections, --only-alpha-carbons, --ignore-hydrogen, --output-aligned-structure, --print-only-rmsd-atoms, --gzip-format, etc.

Example script: demos/demo_rmsd.py

TM-score

  • Python:
from rnapy.toolkit import RNAToolkit

toolkit = RNAToolkit(device="cpu")
result = toolkit.calculate_tm_score(
    structure_1="./demos/input/2zh6_B.pdb",
    structure_2="./demos/input/R1107.pdb",
    mol="rna",
)
print(result["raw_output"])     # Raw TM-score tool output
print(result["tm_score_1"])     # TM-score normalized by length 1
print(result["tm_score_2"])     # TM-score normalized by length 2
  • CLI:
rnapy metric tm-score \
  --struct1 ./demos/input/2zh6_B.pdb \
  --struct2 ./demos/input/R1107.pdb \
  --mol rna

Example script: demos/demo_tm_score.py

Sequence Recovery & Structure F1

Sequence recovery and secondary-structure F1 are common quality metrics for design and prediction.

  • Python:
from rnapy import RNAToolkit

toolkit = RNAToolkit()

# Structure F1 (dot-bracket)
f1 = toolkit.calculate_structure_f1("(((...)))", "(((.....)))")
print(f1)  # {precision, recall, f1_score}

# Sequence recovery rate
recovery = toolkit.calculate_sequence_recovery("AUGCUAGCUAGC", "AUGCUAGCUUGC")
print(recovery["overall_recovery"])  # overall recovery
  • CLI:
# Structure F1
rnapy struct f1 \
  --struct1 "(((...)))" \
  --struct2 "(((.....)))"

# Sequence recovery
rnapy seq recovery \
  --native  AUGCUAGCUAGC \
  --designed AUGCUAGCUUGC

Example script: demos/demo_f1_recovery.py

Command Line Interface (CLI)

The package installs a console script named rnapy (via setup entry point). After installation, you can run rnapy from your shell.

  • Show top-level help:
    • rnapy --help
  • Show help for a subcommand:
    • rnapy seq embed --help

Global options

These options are shared by all subcommands:

  • --device {cpu,cuda}: Computing device (default: cpu)
  • --model {rna-fm,mrna-fm,rhofold,ribodiffusion,rhodesign,rna-msm}: Model provider (required)
  • --model-path PATH: Path to the model checkpoint (required)
  • --config-dir PATH: Configuration directory (default: configs)
  • --provider-config PATH: Optional provider-specific config file
  • --seed INT: Random seed
  • --save-dir DIR: Output directory
  • --verbose or -v: Verbose logs and full tracebacks on errors

Input conventions:

  • Use exactly one of --seq or --fasta
    • --seq accepts a single RNA sequence or multiple sequences separated by commas
    • --fasta accepts a .fasta/.fa/.fas file path

Subcommands

  1. Sequence embeddings

Extract embeddings from RNA-FM/mRNA-FM:

rnapy seq embed \
  --model rna-fm \
  --model-path ./models/RNA-FM_pretrained.pth \
  --seq "AGAUAGUCGUGGGU...UCGGCUAUC" \
  --layer -1 \
  --format mean \
  --save-dir ./results/rna_fm
  • --layer: which layer to use (default: -1, i.e., last layer)
  • --format {raw,mean,bos}: output format (default: mean)
  • You can also pass --fasta path/to/input.fasta instead of --seq
  1. Structure prediction

Predict 2D RNA-FM or 3D (RhoFold) structure:

# 2D with mRNA-FM
rnapy struct predict \
  --model rna-fm \
  --model-path ./models/RNA-FM_pretrained.pth \
  --seq "AGAUAGUCGUGGGU...UCGGCUAUC" \
  --structure-type 2d \
  --save-dir ./results/rna_fm_struct

# 3D with RhoFold (structure-type will auto-infer to 3d)
rnapy struct predict \
  --model rhofold \
  --model-path ./models/RhoFold_pretrained.pt \
  --seq "GGAUCCCGCGCCC...GCCGGGUCC" \
  --save-dir ./results/rhofold_3d
  • If --structure-type is omitted: rhofold -> 3d; rna-fm/mrna-fm -> 2d
  1. Inverse folding (generate sequences from structure)

RiboDiffusion and RhoDesign take a PDB as input:

# RiboDiffusion: generate multiple sequences
rnapy invfold gen \
  --model ribodiffusion \
  --model-path ./models/exp_inf.pth \
  --pdb ./input/R1107.pdb \
  --n-samples 2 \
  --save-dir ./results/ribodiffusion

# RhoDesign: optional 2D guidance via NPY
rnapy invfold gen \
  --model rhodesign \
  --model-path ./models/ss_apexp_best.pth \
  --pdb ./input/2zh6_B.pdb \
  --ss-npy ./input/2zh6_B.npy \
  --save-dir ./results/rhodesign
  • --pdb: required
  • --ss-npy: optional; only used by RhoDesign (2D guidance)
  • --n-samples: number of sequences to sample (RhoDesign samples one per call; RiboDiffusion supports many)
  1. MSA features (RNA-MSM)

Extract embeddings/attention from an aligned MSA:

rnapy msa features \
  --model rna-msm \
  --model-path ./models/RNA_MSM_pretrained_weights.pt \
  --fasta ./input/example_msa.fasta \
  --feature-type embeddings \
  --layer -1 \
  --save-dir ./results/rna_msm_features
  • --feature-type {embeddings,attention,both} (default: embeddings)
  • --layer: which layer to extract (default: -1)
  1. MSA analysis (RNA-MSM)

Compute consensus and/or conservation from an MSA:

rnapy msa analyze \
  --model rna-msm \
  --model-path ./models/RNA_MSM_pretrained_weights.pt \
  --fasta ./input/example_msa.fasta \
  --extract-consensus \
  --extract-conservation \
  --save-dir ./results/rna_msm_analyze
  • If you pass a single --seq (not multiple), this subcommand will error because it requires multiple sequences or a FASTA file
  1. Metrics (structure evaluation)
  • LDDT: see examples above, or run rnapy metric lddt --help
  • RMSD: see examples above, or run rnapy metric rmsd --help
  • TM-score: see examples above, or run rnapy metric tm-score --help
  1. Sequence utilities
  • Structure F1: rnapy struct f1 --struct1 ... --struct2 ...
  • Sequence recovery: rnapy seq recovery --native ... --designed ...

Outputs and logging

  • When --save-dir is provided, results are written under that directory. The exact filenames depend on the provider/task (e.g., .npy for embeddings, .ct for 2D, .pdb/folder for 3D, .json for analysis summaries). The CLI prints a brief summary and (when applicable) a path hint.
  • Exit codes: 0 on success; non-zero on errors. Add -v/--verbose for full tracebacks.

Common pitfalls

  • Do not pass both --seq and --fasta at the same time.
  • Ensure the --model-path points to the correct checkpoint for the chosen --model.
  • rhofold defaults to 3D; RNA-FM/mRNA-FM default to 2D if --structure-type is omitted.
  • msa analyze requires multiple sequences (comma-separated via --seq) or a FASTA file.

Run the Demos

From the repository root:

# mRNA-FM / RNA-FM demo
cd .\demos
python .\demo_rna_fm.py

# RhoFold demo
python .\demo_rhofold.py

# RiboDiffusion demo
python .\demo_ribodiffusion.py

# RhoDesign demo
python .\demo_rhodesign.py

# RNA-MSM demo
python .\demo_rna_msm.py

# LDDT demo
python .\demo_lddt.py

# RMSD demo
python .\demo_rmsd.py

# TM-score demo
python .\demo_tm_score.py

# Sequence recovery & Structure F1 demo
python .\demo_f1_recovery.py

Additional examples may be available: rna_fm_demo.py, rhofold_demo.py, ribodiffusion_demo.py.

Datasets

You can download example datasets via API or CLI (e.g., Rfam, RNA Puzzles, CASP15, etc.).

  • Available dataset names: Rfam, Rfam_original, RNA_Puzzles, CASP15, RNAsolo2

  • CLI:

# List available datasets
rnapy dataset list

# Download Rfam (from the HF mirror) with parallel workers
rnapy dataset download --dataset Rfam --max-workers 8
  • Python:
from rnapy.toolkit import RNAToolkit

toolkit = RNAToolkit()
print(toolkit.list_available_datasets())
toolkit.download_dataset("Rfam", max_workers=8)

Configuration

YAML configs are provided under ./configs/ and ./demos/configs/. You can:

  • Pass config_dir to RNAToolkit to use custom defaults
  • Override per-call parameters in load_model(...) and task methods

License

MIT License

Acknowledgements

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

rnapy-3.2.2.tar.gz (18.2 MB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

rnapy-3.2.2-py3-none-any.whl (18.2 MB view details)

Uploaded Python 3

File details

Details for the file rnapy-3.2.2.tar.gz.

File metadata

  • Download URL: rnapy-3.2.2.tar.gz
  • Upload date:
  • Size: 18.2 MB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/6.2.0 CPython/3.12.5

File hashes

Hashes for rnapy-3.2.2.tar.gz
Algorithm Hash digest
SHA256 a158ed9c1637fdade3f043864c40c1e39aa4d2dcbc5e46203ecf33d721a2055a
MD5 8f5c81af581ab5cfbc0777c254d15a59
BLAKE2b-256 64f83d1d0bdadea95b60736a70f94306587d6e6e750cd36971fa444095b84700

See more details on using hashes here.

File details

Details for the file rnapy-3.2.2-py3-none-any.whl.

File metadata

  • Download URL: rnapy-3.2.2-py3-none-any.whl
  • Upload date:
  • Size: 18.2 MB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/6.2.0 CPython/3.12.5

File hashes

Hashes for rnapy-3.2.2-py3-none-any.whl
Algorithm Hash digest
SHA256 99c3e1e61865b1e2073b65d96296cbe8917a5f2584d7793e3893beec3e14086d
MD5 d73d38d03601ea66aa4929cc15133b19
BLAKE2b-256 8709b8681423b50d45b68f7187bd6f74ddedd0f012ac8e5389d295cdb2b42e3f

See more details on using hashes here.

Release history Release notifications | RSS feed

This release

3.2.2 This release

2 files

3.2.1

2 files

3.1.0

1 file

3.0

1 file

2.0

1 file

0.3.0

1 file

Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page