rnapy 3.0

Unified RNA Analysis Toolkit - ML-powered RNA sequence analysis and structure prediction

RNAPy — Unified RNA Analysis Toolkit

RNAPy is a unified Python toolkit that wraps several powerful RNA models with a consistent, easy-to-use API. It currently integrates:

• RNA-FM / mRNA-FM for sequence embeddings and 2D secondary structure prediction
• RhoFold for 3D structure prediction
• RiboDiffusion for inverse folding (sequence generation from structure)
• RhoDesign for inverse folding (structure-to-sequence, optional 2D guidance)
• RNA-MSM for MSA-based embeddings, attention, consensus, and conservation

Key Features

• Consistent high-level API via RNAToolkit
• 2D structure prediction (RNA-FM / mRNA-FM)
• 3D structure prediction (RhoFold)
• Inverse folding (RiboDiffusion, RhoDesign)
• MSA analysis and features (RNA-MSM: embeddings, attention, consensus, conservation)

Project Structure

RNAPy
├── rnapy/                    # Library source
│   ├── core/                 # Base classes, factory, config, exceptions
│   ├── providers/            # Model providers (rna_fm/mrna_fm, rhofold, RiboDiffusion, rhodesign, rna_msm)
│   ├── interfaces/           # Public interfaces
│   └── utils/                # Utilities
├── configs/                  # Global and model configs (YAML)
├── demos/                    # Ready-to-run examples
│   ├── models/               # Put pretrained weights here
│   ├── results/              # Default output location for demos
│   └── demo_*.py             # Demo scripts
├── requirements.txt
├── setup.py
└── README.md

Installation

Recommended: Python 3.10+ and a recent PyTorch build compatible with your CPU/GPU.

Windows PowerShell example:

# 1) Create and activate a virtual environment (optional but recommended)
python -m venv .venv
.\.venv\Scripts\Activate.ps1

# 2) Install RNAPy in editable mode
pip install -e .

# 3) Install runtime dependencies (if not pulled via setup)
pip install -r requirements.txt

Note: Ensure your installed torch matches your CUDA setup if you plan to use GPU.

Documentation

• Toolkit usage guide: docs/RNAToolkit_Usage_Guide.md

Model Weights

Place checkpoints under ./models/ (paths used in the demos):

• RhoFold: ./models/RhoFold_pretrained.pt
• RiboDiffusion: ./models/exp_inf.pth
• mRNA-FM (or RNA-FM alternative): ./models/mRNA-FM_pretrained.pth (or ./models/RNA-FM_pretrained.pth)
• RhoDesign: ./models/ss_apexp_best.pth (with-2D variant; accepts optional secondary structure file)
• RNA-MSM: ./models/RNA_MSM_pretrained_weights.pt (or RNA_MSM_pretrained.ckpt)

You can customize locations through your own code or configs.

Quick Start

1) mRNA-FM (2D structure + embeddings)

from rnapy import RNAToolkit

sequence = "AGAUAGUCGUGGGUUCCCUUUCUGGAGGGAGAGGGAAUUCCACGUUGACCGGGGGAACCGGCCAGGCCCGGAAGGGAGCAACCGUGCCCGGCUAUC"

# Initialize
toolkit = RNAToolkit(device="cpu")

# Load model (choose one)
model_path = "./models/mRNA-FM_pretrained.pth"  # or RNA-FM_pretrained.pth
toolkit.load_model("mrna-fm", model_path)
# toolkit.load_model("rna-fm", "./models/RNA-FM_pretrained.pth")

# 2D structure prediction
result = toolkit.predict_structure(
    sequence,
    structure_type="2d",
    model="mrna-fm",
    save_dir="./results/rna_fm/demo.ct",
)

# Embeddings
embeddings = toolkit.extract_embeddings(
    sequence,
    model="mrna-fm",
    save_dir="./results/rna_fm/embeddings.npy",
)

print(result.get("secondary_structure"))
print(result.get("confidence_scores"))

2) RhoFold (3D structure prediction)

from rnapy import RNAToolkit

sequence = "GGAUCCCGCGCCCCUUUCUCCCCGGUGAUCCCGCGAGCCCCGGUAAGGCCGGGUCC"

toolkit = RNAToolkit(device="cpu")

# Load RhoFold
toolkit.load_model("rhofold", "./models/RhoFold_pretrained.pt")

# Predict 3D
result = toolkit.predict_structure(
    sequence,
    structure_type="3d",
    model="rhofold",
    save_dir="./results/rhofold",
    relax_steps=500,
)

pdb_file = result.get("structure_3d_refined", result.get("structure_3d_unrelaxed"))
print("3D structure:", pdb_file)

3) RiboDiffusion (inverse folding from PDB)

from rnapy import RNAToolkit

structure_file = "./input/R1107.pdb"

toolkit = RNAToolkit(device="cpu")

# Load RiboDiffusion
toolkit.load_model("ribodiffusion", "./models/exp_inf.pth")

# Generate sequences from structure
result = toolkit.generate_sequences_from_structure(
    structure_file=structure_file,
    model="ribodiffusion",
    n_samples=2,
    sampling_steps=100,
    cond_scale=0.5,
    dynamic_threshold=True,
    save_dir="./results/ribodiffusion",
)

print("Generated count:", result.get("sequence_count", 0))
print("Output dir:", result.get("output_directory"))

4) RhoDesign (inverse folding with optional 2D guidance)

from rnapy import RNAToolkit

pdb_path = "./input/2zh6_B.pdb"
ss_path = "./input/2zh6_B.npy"  # optional numpy file with secondary-structure/contact info

toolkit = RNAToolkit(device="cpu")

# Load RhoDesign (with-2D variant checkpoint)
toolkit.load_model("rhodesign", "./models/ss_apexp_best.pth")

# Generate one sequence from structure (RhoDesign samples one sequence per call)
res = toolkit.generate_sequences_from_structure(
    structure_file=pdb_path,
    model="rhodesign",
    secondary_structure_file=ss_path,  # omit or set None to run without 2D guidance
    save_dir="./results/rhodesign"
)

print("Predicted sequence:", res["sequences"][0])
print("Recovery rate:", res.get("quality_metrics", {}).get("sequence_recovery_rate"))
print("FASTA:", res.get("files", {}).get("fasta_files", [None])[0])

5) RNA-MSM (MSA features, consensus, conservation)

from rnapy import RNAToolkit

# Initialize
toolkit = RNAToolkit(device="cpu")

# Load RNA-MSM
toolkit.load_model("rna-msm", "./models/RNA_MSM_pretrained_weights.pt")

# Prepare an example MSA (aligned sequences)
msa_sequences = [
    "AUGGCGAUUUUAUUUACCGCAGUCGUUACCAACAUACUCGACUUUAAAUGCC",
    "AUGGCAAUUUUAUUUACCGCAGUCGUUACCAACAUACUCGACUUUAAAUGCC",
    "AUGGCGAUUUCAUUUACCGCAGUCGUUACCAACAUACUCGACUUUAAAUGCC",
    "AUGGCGAUUUUAUUUACCGCAGUCGUUACCAGCAUACUCGACUUUAAAUGCC",
]

# Extract embeddings (per-position, last layer by default)
features = toolkit.extract_msa_features(
    msa_sequences,
    feature_type="embeddings",
    model="rna-msm",
    save_dir="./results/rna_msm",
)

# Analyze MSA for consensus and conservation
msa_result = toolkit.analyze_msa(
    msa_sequences,
    model="rna-msm",
    extract_consensus=True,
    extract_conservation=True,
    save_dir="./results/rna_msm",
)

print("Consensus:", msa_result.get("consensus_sequence"))
print("Conservation (first 10):", (msa_result.get("conservation_scores") or [])[:10])

Command Line Interface (CLI)

The package installs a console script named rnapy (via setup entry point). After installation, you can run rnapy from your shell.

• Show top-level help:
  • rnapy --help
• Show help for a subcommand:
  • rnapy seq embed --help

Global options

These options are shared by all subcommands:

• --device {cpu,cuda}: Computing device (default: cpu)
• --model {rna-fm,mrna-fm,rhofold,ribodiffusion,rhodesign,rna-msm}: Model provider (required)
• --model-path PATH: Path to the model checkpoint (required)
• --config-dir PATH: Configuration directory (default: configs)
• --provider-config PATH: Optional provider-specific config file
• --seed INT: Random seed
• --save-dir DIR: Output directory
• --verbose or -v: Verbose logs and full tracebacks on errors

Input conventions:

• Use exactly one of --seq or --fasta
  • --seq accepts a single RNA sequence or multiple sequences separated by commas
  • --fasta accepts a .fasta/.fa/.fas file path

Subcommands

1. Sequence embeddings

Extract embeddings from RNA-FM/mRNA-FM:

rnapy seq embed \
  --model mrna-fm \
  --model-path ./models/mRNA-FM_pretrained.pth \
  --seq "AGAUAGUCGUGGGU...UCGGCUAUC" \
  --layer -1 \
  --format mean \
  --save-dir ./results/rna_fm

• --layer: which layer to use (default: -1, i.e., last layer)
• --format {raw,mean,bos}: output format (default: mean)
• You can also pass --fasta path/to/input.fasta instead of --seq

2. Structure prediction

Predict 2D (RNA-FM / mRNA-FM) or 3D (RhoFold) structure:

# 2D with mRNA-FM
rnapy struct predict \
  --model mrna-fm \
  --model-path ./models/mRNA-FM_pretrained.pth \
  --seq "AGAUAGUCGUGGGU...UCGGCUAUC" \
  --structure-type 2d \
  --save-dir ./results/rna_fm_struct

# 3D with RhoFold (structure-type will auto-infer to 3d)
rnapy struct predict \
  --model rhofold \
  --model-path ./models/RhoFold_pretrained.pt \
  --seq "GGAUCCCGCGCCC...GCCGGGUCC" \
  --save-dir ./results/rhofold_3d

• If --structure-type is omitted: rhofold -> 3d; rna-fm/mrna-fm -> 2d

3. Inverse folding (generate sequences from structure)

RiboDiffusion and RhoDesign take a PDB as input:

# RiboDiffusion: generate multiple sequences
rnapy invfold gen \
  --model ribodiffusion \
  --model-path ./models/exp_inf.pth \
  --pdb ./input/R1107.pdb \
  --n-samples 2 \
  --save-dir ./results/ribodiffusion

# RhoDesign: optional 2D guidance via NPY
rnapy invfold gen \
  --model rhodesign \
  --model-path ./models/ss_apexp_best.pth \
  --pdb ./input/2zh6_B.pdb \
  --ss-npy ./input/2zh6_B.npy \
  --save-dir ./results/rhodesign

• --pdb: required
• --ss-npy: optional; only used by RhoDesign (2D guidance)
• --n-samples: number of sequences to sample (RhoDesign samples one per call; RiboDiffusion supports many)

4. MSA features (RNA-MSM)

Extract embeddings/attention from an aligned MSA:

rnapy msa features \
  --model rna-msm \
  --model-path ./models/RNA_MSM_pretrained_weights.pt \
  --fasta ./input/example_msa.fasta \
  --feature-type embeddings \
  --layer -1 \
  --save-dir ./results/rna_msm_features

• --feature-type {embeddings,attention,both} (default: embeddings)
• --layer: which layer to extract (default: -1)

5. MSA analysis (RNA-MSM)

Compute consensus and/or conservation from an MSA:

rnapy msa analyze \
  --model rna-msm \
  --model-path ./models/RNA_MSM_pretrained_weights.pt \
  --fasta ./input/example_msa.fasta \
  --extract-consensus \
  --extract-conservation \
  --save-dir ./results/rna_msm_analyze

• If you pass a single --seq (not multiple), this subcommand will error because it requires multiple sequences or a FASTA file

Outputs and logging

• When --save-dir is provided, results are written under that directory. The exact filenames depend on the provider/task (e.g., .npy for embeddings, .ct for 2D, .pdb/folder for 3D, .json for analysis summaries). The CLI prints a brief summary and (when applicable) a path hint.
• Exit codes: 0 on success; non-zero on errors. Add -v/--verbose for full tracebacks.

Common pitfalls

• Do not pass both --seq and --fasta at the same time.
• Ensure the --model-path points to the correct checkpoint for the chosen --model.
• rhofold defaults to 3D; RNA-FM/mRNA-FM default to 2D if --structure-type is omitted.
• msa analyze requires multiple sequences (comma-separated via --seq) or a FASTA file.

Run the Demos

From the repository root:

# mRNA-FM / RNA-FM demo
cd .\demos
python .\demo_rna_fm.py

# RhoFold demo
python .\demo_rhofold.py

# RiboDiffusion demo
python .\demo_ribodiffusion.py

# RhoDesign demo
python .\demo_rhodesign.py

# RNA-MSM demo
python .\demo_rna_msm.py

Additional examples may be available: rna_fm_demo.py, rhofold_demo.py, ribodiffusion_demo.py.

Configuration

YAML configs are provided under ./configs/ and ./demos/configs/. You can:

• Pass config_dir to RNAToolkit to use custom defaults
• Override per-call parameters in load_model(...) and task methods

Example (global excerpt):

global:
  device: "cpu"
  precision: "float32"
  cache_dir: "./cache"

Model-specific YAMLs (e.g., rna_fm.yaml, rhofold.yaml, ribodiffusion.yaml) control provider defaults. For models without a dedicated YAML, pass options via load_model(..., **kwargs) or call-time kwargs.

License

MIT License

Acknowledgements

• RNA-FM: https://github.com/ml4bio/RNA-FM
• RhoFold: https://github.com/ml4bio/RhoFold
• RiboDiffusion: https://github.com/ml4bio/RiboDiffusion
• RhoDesign: https://github.com/ml4bio/RhoDesign
• RNA-MSM: https://github.com/yikunpku/RNA-MSM