Skip to main content

S³N²Bin (Semi-supervised Siamese Neural Network for metagenomic binning)

Test Status Documentation Status License: MIT

NOTE: This tool is still in development. You are welcome to try it out and feedback is appreciated, but expect some bugs/rapid changes until it stabilizes. Please use Github issues for bug reports and the Discussions for more open-ended discussions/questions.

Command tool for metagenomic binning with semi-supervised deep learning using information from reference genomes.

Install

S3N2Bin runs on Python 3.6-3.8.

Install from source

You can download the source code from github and install.

Install dependence packages using conda: Bedtools, Hmmer, Fraggenescan and cmake.

conda install -c bioconda bedtools hmmer fraggenescan
conda install -c anaconda cmake=3.19.6
python setup.py install

Examples

Easy single/co-assembly binning mode

You will need the following inputs:

  1. A contig file (contig.fna in the example below)
  2. BAM files from mapping

You can get the results with one line of code. The single_easy_bin command can be used in single-sample and co-assembly binning modes (contig annotations using mmseqs with GTDB reference genome). single_easy_bin includes the following steps: predict_taxonomy,generate_data_single and bin.

S3N2Bin single_easy_bin -i contig.fna -b *.bam -o output

In this example, S³N²Bin will download GTDB to $HOME/.cache/S3N2Bin/mmseqs2-GTDB/GTDB. You can change this default using the -r argument.

Easy multi-samples binning mode

The multi_easy_bin command can be used in multi-samples binning modes (contig annotations using mmseqs with GTDB reference genome). multi_easy_bin includes following step: predict_taxonomy, generate_data_multi and bin.

You will need the following inputs.

  1. A combined contig file

  2. BAM files from mapping

For every contig, format of the name is <sample_name>:<contig_name>, where : is the default separator (it can be changed with the --separator argument). Note: Make sure the sample names are unique and the separator does not introduce confusion when splitting. For example:

>S1:Contig_1
AGATAATAAAGATAATAATA
>S1:Contig_2
CGAATTTATCTCAAGAACAAGAAAA
>S1:Contig_3
AAAAAGAGAAAATTCAGAATTAGCCAATAAAATA
>S2:Contig_1
AATGATATAATACTTAATA
>S2:Contig_2
AAAATATTAAAGAAATAATGAAAGAAA
>S3:Contig_1
ATAAAGACGATAAAATAATAAAAGCCAAATCCGACAAAGAAAGAACGG
>S3:Contig_2
AATATTTTAGAGAAAGACATAAACAATAAGAAAAGTATT
>S3:Contig_3
CAAATACGAATGATTCTTTATTAGATTATCTTAATAAGAATATC

You can get the results with one line of code.

S3N2Bin multi_easy_bin -i contig_whole.fna -b *.bam -o output

Advanced-bin mode

You can run individual steps by yourself, which can enable using compute clusters to make the binning process faster (especially in multi-samples binning mode).

For more details on usage, including information on how to run individual steps separately, read the docs.

Output

The output folder will contain

  1. Datasets used for training and clustering.

  2. Saved semi-supervised deep learning model.

  3. Output bins.

  4. Some intermediate files.

For every sample, reconstructed bins are in output_recluster_bins directory.

For more details about the output, read the docs.

Metadata

Release files for S3N2Bin 0.1.1

For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.

Source distribution (sdist)

Source distribution for S3N2Bin 0.1.1
File Size Uploaded
S3N2Bin-0.1.1.tar.gz 2.9 MB Details

Release files / S3N2Bin-0.1.1.tar.gz

Download URL S3N2Bin-0.1.1.tar.gz
Size 2.9 MB
Tags Source
SHA-256 checksum
How to use checksums
0b4490dd3f68dea92aba74857123d3320b03ff41ab97c5677bfe99286bd72027
BLAKE2b-256 checksum
How to use checksums
46d6456e958d820cf1a0472ec951341b9056f73e9633b046a4de39a2e2f10084
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
No
Uploaded via twine/3.4.1 importlib_metadata/3.7.3 pkginfo/1.7.0 requests/2.24.0 requests-toolbelt/0.9.1 tqdm/4.49.0 CPython/3.8.6

Release history Release notifications | RSS feed

This release

0.1.1 This release

1 release file

0.1.0

1 release file

Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page