Skip to main content

schic

schic is a Python package for analyzing sc-hic data.

Table of Contents

Overview

schic

Requirements

  1. Python 3.10+
  2. cutadapt 2.10+
  3. pairtools 2.2.3+

schic modules

schic provides a set of modules for analyzing sc-hic data. The modules are:

  • whitelist
  • extract
  • cutadapt
  • contacts
  • report

schic whitelist

Usage

cd 01_whitelist

bc_pattern='(?P<discard_1>ACATGGCTACGATCCGACTTTCTGCG)(?P<cell_1>.{10})(?P<discard_2>CCTTCC)(?P<cell_2>.{10})(?P<discard_3>TCGTCGGCAGCGTCAGATGTGTATA)(?P<umi_1>.{1}).*'

NUM=$(cat ../config/sample|wc -l)
cat ../config/sample|xargs -n 1 -P ${NUM} -i -t bash -e -c \
    """
        schic whitelist \
            --bc-pattern='${bc_pattern}' \
            --stdin ../input/{}/{}_R1.fastq.gz \
            --set-cell-number=5000 \
            --plot-prefix={}_whitelist \
            --stdout={}_whitelist.txt
    """

schic extract

Usage

cd 02_extract
bc_pattern='(?P<discard_1>ACATGGCTACGATCCGACTTTCTGCG)(?P<cell_1>.{10})(?P<discard_2>CCTTCC)(?P<cell_2>.{10})(?P<discard_3>TCGTCGGCAGCGTCAGATGTGTATA)(?P<umi_1>.{8}).*'

NUM=$(cat ../config/sample|wc -l)
cat ../config/sample|xargs -n 1 -P ${NUM} -i -t bash -e -c \
    """
    schic extract \
        --bc-pattern='${bc_pattern}' \
        --stdin ../input/{}/{}_R1.fastq.gz \
        --stdout {}_R1.extracted.fastq.gz \
        --read2-in ../input/{}/{}_R2.fastq.gz \
        --read2-out {}_R2.extracted.fastq.gz \
        --whitelist=../reference/barcodes/whitelist.txt
    """

schic cutadapt

Usage

cd 03_cutadapt

NUM=$(cat ../config/sample|wc -l)
cat ../config/sample|xargs -n 1 -P ${NUM} -i -t bash -e -c \
    """
    schic cutadapt \
        --read1 ../02_extract/{}_R1.extracted.fastq.gz \
        --read2 ../02_extract/{}_R2.extracted.fastq.gz \
        --read1-out {}_R1.trimmed.fastq.gz \
        --read2-out {}_R2.trimmed.fastq.gz \
        --params='-a CTGTCTCTTATACACATCT -A AGATGTGTATAAGAGACAG'
    """

schic contacts

Usage

cd 03_contacts

NUM=$(cat ../config/sample|wc -l)
cat ../config/sample|xargs -n 1 -P ${NUM} -i -t bash -e -c \
    """
    schic contacts \
        --read1 ../03_cutadapt/{}_R1.trimmed.fastq.gz \
        --read2 ../03_cutadapt/{}_R2.trimmed.fastq.gz \
        --reference ../reference/index/bwa/genome \
        --genome-size ../reference/index/bwa/genome.size \
        --prefix {} \
        --threads 8
    
    """
# test
schic contacts \
    --read1 ../03_cutadapt/T4-Bioth-long_R1.trimmed.fastq.gz \
    --read2 ../03_cutadapt/T4-Bioth-long_R2.trimmed.fastq.gz \
    --reference ../reference/index/bwa/genome \
    --genome-size ../reference/index/bwa/genome.size \
    --prefix T4-Bioth-long \
    --filter 3 \
    --threads 16

Docker

If the user has docker installed, the following command can be used to run the pipeline in a docker container:

docker run -v /path/to/data:/data -it schic/schic:latest /bin/bash

Conda Environment

If the user has conda installed, the following command can be used to create a conda environment for schic:

  1. Install conda
  2. Create a new conda environment: conda create -n schic python=3.10
  3. Activate the environment: conda activate schic
  4. Install the required packages: conda install -c bioconda samtools bedtools
  5. Install the required python packages: pip install pandas numpy scipy sklearn matplotlib seaborn pysam

Cite schic

If you use schic in your research, please cite the following paper:

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

schic-0.2.4.tar.gz (16.5 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

schic-0.2.4-py3-none-any.whl (21.2 kB view details)

Uploaded Python 3

File details

Details for the file schic-0.2.4.tar.gz.

File metadata

  • Download URL: schic-0.2.4.tar.gz
  • Upload date:
  • Size: 16.5 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: poetry/2.3.3 CPython/3.12.8 Linux/5.15.0-173-generic

File hashes

Hashes for schic-0.2.4.tar.gz
Algorithm Hash digest
SHA256 b2b210dd001fcf8ee6852b13ac303bf499bfaf618f0b7bc967245c247024fe19
MD5 da7f36ee3aad2466583e5d60afd50081
BLAKE2b-256 3b869670a03a3f9d822838b6b02075f80ac25e18eddac041e7e59daf1c80b3ba

See more details on using hashes here.

File details

Details for the file schic-0.2.4-py3-none-any.whl.

File metadata

  • Download URL: schic-0.2.4-py3-none-any.whl
  • Upload date:
  • Size: 21.2 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: poetry/2.3.3 CPython/3.12.8 Linux/5.15.0-173-generic

File hashes

Hashes for schic-0.2.4-py3-none-any.whl
Algorithm Hash digest
SHA256 c1c53e43a9814221b5c71f02b3a696ae4b30f1f84c04cda138d701a46db30e79
MD5 f852867c8c48daed8905687478062989
BLAKE2b-256 d1ba43e1e17895a4fda052a7ee0a513d55978d30a46f5b2614953cafbc3f7ecf

See more details on using hashes here.

Release history Release notifications | RSS feed

This release

0.2.4 This release

2 files

0.2.2

2 files

0.2.0

2 files

0.1.9

2 files

0.1.7

2 files

0.1.6

2 files

0.1.5

2 files

0.1.4

2 files

0.1.3

2 files

0.1.2

2 files

Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page