Skip to main content

simple_blast

This is a library that provides a (decreasingly) basic wrapper around ncbi-blast+. Currently, the library supports searches with blastn only, but I may expand the library to include wrappers for other BLAST executables if I need them.

Dependencies

  • Pandas (>= 1.5.6)
  • ncbi-blast+ (>= 2.12.0+)

Optional

  • Biopython (>= 1.84, for SAM parsing and support for searching with SeqRecord)
  • pyblast4_archive (>= 0.0.7, for conversion to SAM format)
  • pysam (>= 0.23.1, for conversion to SAM format)

Basic usage

You can define a blastn search to be carried out using the BlastnSearch class. BlastnSearchobjects are constructed with two required arguments—the subject sequence and the query sequence files, in that order. For example, to set up a blastn search for sequences in seqs1.fasta against those in seqs2.fasta using output format 12 (Seqalign), you could construct a BlastnSearch object like this:

from simple_blast import BlastnSearch

search = BlastnSearch(21, "seqs1.fasta", "seqs2.fasta")

The BLAST search is not carried out until you ask for the results by running the get_output() function.

results = search.get_output()

blastn can output binary data, so the get_output() function appropriately returns bytes.

Often, it's convenient to use output format 6, a tabular representation of the HSPs. For that purpose, you can use TabularBlastnSearch.

from simple_blast import TabularBlastnSearch

search = TabularBlastnSearch("seqs1.fasta", "seqs2.fasta")

The hits property of the search returns a Pandas dataframe containing the HSPs identified in the BLAST search.

results = search.hits

The columns in the output may be configured by passing either the out_columns or additional_columns arguments when constructing the TabularBlastnSearch. The former argument overrides the set of output columns; the latter argument is added to the list of default output columns.

Sequences from memory

simple_blast can handle BLAST searches with sequences stored in memory (i.e., not in a file). It works with sequences stored as strings or in BioPython SeqRecord objects.

from Bio.SeqRecord import SeqRecord, Seq
from simple_blast import TabularBlastnSearch

# Define some data.
subjects = [
    SeqRecord(
	    Seq(
		"AAGGCGTACGGGCCTTTCGCTTCCGAAAACTTCCTCTTAGGTCGCTGTTACTGGATGTCGAGTCAGCACA"
		"TGGGAAACTCCACGCATCGGCGGGATTTCACAACGCCTAGAACACCGGTAATGCGAGTATCCGTATCGGT"
		"AACAAATATCTTTGGGATACTACAGGAATATCCGTAGGAGTTCGCCGCGATTAGGTGCCTCGATGATATG"
		"CAGCTGTCACTGGAGATAACACACTATGCAGCAGTAATGGATGTTATTGCTACTAAGGTTCCCTGTCACC"
	    ),
		id="My Sequence 1"
	),
    SeqRecord(
	    Seq(
		"TTCATTGGTGGGCTTTCTGGTTCACGCCCATCTCAATGTACATTTTCCGTGACGTGATGATAATCATAAC"
		"TCGTTGGTAGTAATAGGGTAAGGGAATTTGGCAGGTAGTCGGGGCAAGACTGCCGTTACAAGCTAATCAT"
		"CTGCCAACTAACTTTAGCCGTAATTGGCACTAACAGTTAACCTTCGCGCGTTTCTCAGTGTAGAGTGAGA"
		"CTATGTGATTACTTTCAGCGCCCAGCGGTGGTAGGTAGTAAAAAGTGGCCACCGAACCGAATGCT"
	    ),
		id="My Sequence 2"
	)
]
queries = [
    SeqRecord(
        Seq("TGGGAAACTCCACGCATCGGCGGGATTTCACAACGCCTAGAACACCGGTAATGCGAGTATCCGT"),
        id="Query 1"
    )
]

with TabularBlastnSearch.from_sequences(queries, subjects) as search:
    results = search.hits

or, using a list of strings:

from simple_blast import TabularBlastnSearch

# Define some data.
subjects = [
    (
        "AAGGCGTACGGGCCTTTCGCTTCCGAAAACTTCCTCTTAGGTCGCTGTTACTGGATGTCGAGTCAGCACA"
        "TGGGAAACTCCACGCATCGGCGGGATTTCACAACGCCTAGAACACCGGTAATGCGAGTATCCGTATCGGT"
        "AACAAATATCTTTGGGATACTACAGGAATATCCGTAGGAGTTCGCCGCGATTAGGTGCCTCGATGATATG"
        "CAGCTGTCACTGGAGATAACACACTATGCAGCAGTAATGGATGTTATTGCTACTAAGGTTCCCTGTCACC"
    ),
    (
        "TTCATTGGTGGGCTTTCTGGTTCACGCCCATCTCAATGTACATTTTCCGTGACGTGATGATAATCATAAC"
        "TCGTTGGTAGTAATAGGGTAAGGGAATTTGGCAGGTAGTCGGGGCAAGACTGCCGTTACAAGCTAATCAT"
        "CTGCCAACTAACTTTAGCCGTAATTGGCACTAACAGTTAACCTTCGCGCGTTTCTCAGTGTAGAGTGAGA"
        "CTATGTGATTACTTTCAGCGCCCAGCGGTGGTAGGTAGTAAAAAGTGGCCACCGAACCGAATGCT"
    )
]
queries = ["TGGGAAACTCCACGCATCGGCGGGATTTCACAACGCCTAGAACACCGGTAATGCGAGTATCCGT"]

with TabularBlastnSearch.from_sequences(queries, subjects as search:
    results = search.hits

When using a list of strings, sequences are automatically named seq_i, where i is the position of the sequence in the list.

You can use SeqRecords together with lists of strings, and you can also use in-memory sequences together with files by providing the subject or query keyword arguments to from_sequences.

TabularBlastnSearch.from_sequences(
    subject_seqs=["CATGAACTA"],
	query="seqs1.fasta"
)

Since using a context manager is slightly cumbersome, you can also use the blastn_from_sequences convenience function to get the hits for a search.

from simple_blast import blastn_from_sequences

# Define some data.
subjects = [
    (
        "AAGGCGTACGGGCCTTTCGCTTCCGAAAACTTCCTCTTAGGTCGCTGTTACTGGATGTCGAGTCAGCACA"
        "TGGGAAACTCCACGCATCGGCGGGATTTCACAACGCCTAGAACACCGGTAATGCGAGTATCCGTATCGGT"
        "AACAAATATCTTTGGGATACTACAGGAATATCCGTAGGAGTTCGCCGCGATTAGGTGCCTCGATGATATG"
        "CAGCTGTCACTGGAGATAACACACTATGCAGCAGTAATGGATGTTATTGCTACTAAGGTTCCCTGTCACC"
    ),
    (
        "TTCATTGGTGGGCTTTCTGGTTCACGCCCATCTCAATGTACATTTTCCGTGACGTGATGATAATCATAAC"
        "TCGTTGGTAGTAATAGGGTAAGGGAATTTGGCAGGTAGTCGGGGCAAGACTGCCGTTACAAGCTAATCAT"
        "CTGCCAACTAACTTTAGCCGTAATTGGCACTAACAGTTAACCTTCGCGCGTTTCTCAGTGTAGAGTGAGA"
        "CTATGTGATTACTTTCAGCGCCCAGCGGTGGTAGGTAGTAAAAAGTGGCCACCGAACCGAATGCT"
    )
]
queries = ["TGGGAAACTCCACGCATCGGCGGGATTTCACAACGCCTAGAACACCGGTAATGCGAGTATCCGT"]

results = blastn_from_sequences(queries, subjects)

Note: Searching from in-memory sequences is implemented using Unix FIFOs, so this feature currently will not work on Windows.

DB caches

When the same sequence file is used as a subject in multiple searches, it can be efficient to build a BLAST database up front. The BlastDBCache class can be used to handle this mostly automatically. To make a BlastDBCache, you need to specify the location of the on the file system.

from simple_blast import BlastDBCache

cache = BlastDBCache("cache_dir")

To add a file to the cache, use the makedb method.

cache.makedb("seqs2.fasta")

When constructing a BlastnSearch object, give it the BlastDBCache as the db_cache parameter to make the BlastnSearch object use the cache for searches.

search = BlastnSearch(12, "seqs1.fasta", "seqs2.fasta", db_cache=cache)

Now search will use the database we created for seqs2.fasta.

Explicit database searches

Rather than searching against a FASTA file or a database created implicitly with BlastDBCache, you can also explicitly specify a database to query with the db keyword argument.

search = BlastnSearch(12, "seqs1.fasta", db="mydb")

Remote searches

You can query the NCBI databases remotely using the remote parameter.

search = BlastnSearch(12, "seqs1.fasta", db="nr", remote=True)

Format conversions

It's sometimes useful to convert between different BLAST output formats. ncbi-blast+ comes with a utility, blast_formatter, that can convert output in the "Blast4 Archive" format (ASN.1, output format 11) to any other BLAST format.

Using blast_formatter with simple_blast.convert

You can use blast_formatter directly with the simple_blast.convert module. For example,

from simple_blast.convert import blast_format_file

# Convert to output format 11.
blast_format_file(12, "my_blast_results.asn1", "my_blast_results.json")

If you don't specify the output file, you can get the output as bytes.

seqalign_bytes = blast_format_file(12, "my_blast_results.asn1")

You can also use the similar blast_format_bytes to provide bytes as input.

Using MultiformatBlastnSearch

You can create a search with output format 11 using the MultiformatBlastnSearch class.

from simple_blast.multiformat import MultiformatBlastnSearch

search = MultiformatBlastnSearch("seqs1.fasta", "seqs2.fasta")

You can convert the output to another format using the to method.

seqalign_bytes = search.to(12)

For output formats with an associated subclass of BlastnSearch, you can also convert directly to that subclass with to_search..

tabular_search = search.to_search(6)
results = tabular_search.hits # A Pandas DataFrame

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

simple_blast-0.7.9.tar.gz (437.4 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

simple_blast-0.7.9-py3-none-any.whl (24.2 kB view details)

Uploaded Python 3

File details

Details for the file simple_blast-0.7.9.tar.gz.

File metadata

  • Download URL: simple_blast-0.7.9.tar.gz
  • Upload date:
  • Size: 437.4 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/6.0.1 CPython/3.12.8

File hashes

Hashes for simple_blast-0.7.9.tar.gz
Algorithm Hash digest
SHA256 8c4ccc176d200c4171f7474f8e19bc75e9e65bb398012a3ab9e554180ba4539c
MD5 66024c377135444045b652b0dc79fbcd
BLAKE2b-256 5b30f4d46f7fe1957e05641d1e6fde227f2b28a61d75d9bc464c2552c790d5b3

See more details on using hashes here.

Provenance

The following attestation bundles were made for simple_blast-0.7.9.tar.gz:

Publisher: package.yml on actapia/simple_blast

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file simple_blast-0.7.9-py3-none-any.whl.

File metadata

  • Download URL: simple_blast-0.7.9-py3-none-any.whl
  • Upload date:
  • Size: 24.2 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/6.0.1 CPython/3.12.8

File hashes

Hashes for simple_blast-0.7.9-py3-none-any.whl
Algorithm Hash digest
SHA256 642dfb667622c1ffb7bce3991e1fd84f3e50650ec4741693b6ae6aec503686e6
MD5 97543e5b57c14b107e45af065f88cc52
BLAKE2b-256 9afcdf84b1722a172c695545c5cfe1acf058e4099cab0ab4e1e40aa9c086cda0

See more details on using hashes here.

Provenance

The following attestation bundles were made for simple_blast-0.7.9-py3-none-any.whl:

Publisher: package.yml on actapia/simple_blast

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

Release history Release notifications | RSS feed

This release

0.7.9 This release

2 files

0.7.8

2 files

0.7.7

2 files

0.7.6

2 files

0.7.5

2 files

0.7.4

2 files

0.7.3

2 files

0.7.2

2 files

0.7.1

2 files

0.7.0

2 files

0.6.0

2 files

0.5.0

2 files

0.4.0

2 files

0.3.0

2 files

0.2.0

2 files

0.1.5

2 files

0.1.4

2 files

0.0.5

2 files

Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page