Skip to main content

Welcome to SingleM.

SingleM is a tool to find the abundances of discrete operational taxonomic units (OTUs) directly from shotgun metagenome data, without heavy reliance on reference sequence databases. It is able to differentiate closely related species even if those species are from lineages new to science.

Where [GraftM](https://github.com/geronimp/graftM) can give a taxonomic overview of your community e.g. proportion of a community from a particular taxonomic family, SingleM finds sequence-based OTUs from raw, untrimmed metagenomic reads.

This gives you the ability to answer questions such as:

  • How many different kinds of TM6 do I have?

  • What is the Chao 1 diversity of my sample?

  • Are the Acidobacteria in sample 1 very closely related to the Acidobacteria in sample 2?

  • Do I have population genomes for the main community members?

  • How diverse are the Pelagibacteria relative to the Flavobacteria?

  • Has my genome been observed in any samples submitted to the [SRA](http://www.ncbi.nlm.nih.gov/sra)?

  • Which community members are more likely to assemble?

## Generating an OTU table

An overview of your community can be obtained like so: ` singlem pipe --sequences my_sequences.fastq.gz --otu_table otu_table.csv --threads 24 ` Please use raw metagenome reads, not quality trimmed reads. Quality trimming with e.g. [Trimmomatic](https://doi.org/10.1093/bioinformatics/btu170) reads often makes them too short for SingleM to use. On the other hand, adapter trimming is unlikely to be detrimental.

The output table consists of columns: ` gene sample sequence num_hits coverage taxonomy 4.21.ribosomal_protein_S19_rpsS my_sequences TGGTCGCGCCGTTCGACGGTCACTCCGGACTTCATCGGCCTACAGTTCGCCGTGCACATC 1 1.64 Root; d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__Desulfuromonadales 4.21.ribosomal_protein_S19_rpsS my_sequences TGGTCGCGGCGCTCAACCATTCTGCCCGAGTTCGTCGGCCACACCGTGGCCGTTCACAAC 1 1.64 Root; d__Bacteria; p__Acidobacteria; c__Solibacteres; o__Solibacterales; f__Solibacteraceae; g__Candidatus_Solibacter; s__Candidatus_Solibacter_usitatus ` 1. marker name 2. sample name 3. sequence of the OTU 4. number of reads detected from that OTU 5. estimated coverage of a genome from this OTU 6. “median” taxonomic classification of each of the reads in the OTU according to [pplacer](http://matsen.fhcrc.org/pplacer/)

Currently SingleM concentrates on 15 single copy marker genes to provide fine-grained differentiation of species that is independent of the copy-number variation issues that hamper 16S analyses. SingleM is reasonably fast and is quite scalable, although there is much room for improvement. On average, each of the 15 genes better differentiates closely related lineages than a typical 16S amplicon-based study.

## Further processing of OTU tables ### Summarising OTU tables Once an OTU table has been generated with the pipe command, it can be further processed in various ways using summarise:

Create a [Krona](https://sourceforge.net/p/krona/) plot of the community. The following command generates my_krona*.html files which can be viewed in a web browser: ` singlem summarise --input_otu_table otu_table.csv --krona my_krona `

Cluster sequences, collapsing them into OTUs with less resolution, but with more robustness against sequencing error: ` singlem summarise --input_otu_table otu_table.csv --cluster --clustered_output_otu_table clustered.otu_table.csv `

Rarefy a set of OTU tables so that each sample contains the same number of OTU sequences: ` singlem summarise --input_otu_tables otu_table.csv other_samples.otu_table.csv --rarefied_output_otu_table rarefied.otu_table.csv --number_to_choose 100 `

Conversion to [BIOM format](http://biom-format.org) for use with QIIME: ` singlem summarise --input_otu_tables otu_table.csv other_samples.otu_table.csv --biom_prefix myprefix ` This generates a BIOM table for each marker gene e.g. myprefix.4.12.ribosomal_protein_L11_rplK.biom.

### Calculating beta diversity between samples As SingleM generates OTUs that are independent of taxonomy, they can be used as input to beta diversity methods known to be appropriate for the analysis of 16S amplicon studies, of which there are many. We recommend [express beta diversity](https://github.com/dparks1134/ExpressBetaDiversity) (EBD) as it implements many different metrics with a unified interface. For instance to calculate Bray-Curtis beta diversity, first convert your OTU table to unifrac format using singlem summarise: ` singlem summarise --input_otu_table otu_table.csv --unifrac otu_table.unifrac ` The above commands generates 15 different unifrac format files, one for each marker gene used in SingleM. At this point, you need to choose one table to proceed with. Hopefully, the choice matters little, but it might pay to use multiple tables and ensure that the results are consistent.

To calculate beta diversity, use the EBD script convertToEBD.py to convert the unifrac format into ebd format, and calculate the diversity metric: ` convertToEBD.py otu_table.unifrac.4.12.ribosomal_protein_L11_rplK.unifrac otu_table.ebd ExpressBetaDiversity -s otu_table.ebd -c Bray-Curtis ` Phylogenetic tree-based methods of calculating beta diversity can also be calculated, but pipe must be used to generate a new OTU table using the diamond_example taxonomy assignment method so that each OTU is assigned to a single leaf in the tree: ` singlem pipe --sequences my_sequences.fastq.gz --otu_table otu_table.diamond_example.csv --threads 24 --assignment_method diamond_example singlem summarise --otu_tables otu_table.diamond_example.csv --unifrac otu_table.diamond_example.csv convertToEBD.py otu_table.diamond_example.unifrac otu_table.diamond_example.ebd ExpressBetaDiversity -s otu_table.diamond_example.ebd -c Bray-Curtis -t `singlem get_tree --marker_name 4.21.ribosomal_protein_S19_rpsS` `

### Creating and querying SingleM databases It can be useful in some situations to search for sequences in OTU tables. For instance, you may ask “is the most abundant OTU or anything similar in samples B, C or D?” To answer this question make a SingleM database from sample B, C & D’s OTU tables: ` singlem makedb --otu_tables sample_B.csv sample_C.csv sample_D.csv --db_path sample_BCD.sdb ` .sdb is the conventional file extension for SingleM databases. Then to query this database ` singlem query --query_sequence TGGTCGCGGCGCTCAACCATTCTGCCCGAGTTCGTCGGCCACACCGTGGCCGTTCACAAC --db sample_BCD.sdb `

### Appraising genome recovery efforts To assess how well a set of genomes (or population genomes) represent those present in a metagenome, first run pipe on both the genomes and the raw reads, and then use appraise: ` singlem appraise --metagenome_otu_tables metagenome.otu_table.csv --genome_otu_tables genomes.otu_table.csv ` One may also accommodate some sequence differences, with –imperfect, or output OTU tables of OTUs in the genomes or not in the genomes with –accounted_for_otu_table and –unaccounted_for_otu_table.

### Installation

#### Installation via GNU Guix The most straightforward way of installing SingleM is to use the GNU Guix package which is part of the ACE Guix package collection. This method installs not just the Python libraries required but the compiled bioinformatics tools needed as well. Once you have installed Guix, clone the ACE collection and install: ` git clone https://github.com/Ecogenomics/ace-guix GUIX_PACKAGE_PATH=ace-guix guix package --install singlem ` Beyond installing GNU Guix, super-user privileges are not required for installation.

#### Installation via DockerHub A docker image generated from the Guix package is available on DockerHub. After installing Docker: ` docker pull wwood/singlem ` If the sequence data to be analyzed is in the current working directory, SingleM can be used like so: ` docker run -v `pwd`:`pwd` wwood/singlem singlem pipe --sequences `pwd`/my.fastq.gz --otu_table `pwd`/my.otu_table.csv --threads 15 `

#### Installation via PyPI To install the Python libraries required: ` pip install graftm pip install singlem ` You may need super-user privileges.

SingleM also has the following non-Python dependencies: * [BLAST+](http://blast.ncbi.nlm.nih.gov/Blast.cgi) * [VSEARCH](https://github.com/torognes/vsearch)

Some dependencies of [GraftM](https://github.com/geronimp/graftM): * [OrfM](https://github.com/wwood/OrfM) >= 0.2.0 * [HMMER](http://hmmer.janelia.org/) >= 3.1b1 * [fxtract](https://github.com/ctSkennerton/fxtract) * [pplacer](http://matsen.fhcrc.org/pplacer/) >= 1.1.alpha17 * [KronaTools](http://sourceforge.net/p/krona/home/krona/) >= 2.4 * [diamond](https://github.com/bbuchfink/diamond) >= 0.9

## Help If you have any questions or comments, send a message to the [SupportM mailing list](https://groups.google.com/forum/?utm_medium=email&utm_source=footer#!forum/supportm) or raise a [GitHib issue](https://github.com/wwood/singlem/issues).

## License SingleM is written by [Ben Woodcroft](http://ecogenomic.org/personnel/dr-ben-woodcroft) (@wwood) at the [Australian Centre for Ecogenomics (UQ)](http://ecogenomic.org/) and is licensed under [GPL3 or later](https://gnu.org/licenses/gpl.html).

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

singlem-0.8.0.tar.gz (38.9 MB view details)

Uploaded Source

File details

Details for the file singlem-0.8.0.tar.gz.

File metadata

  • Download URL: singlem-0.8.0.tar.gz
  • Upload date:
  • Size: 38.9 MB
  • Tags: Source
  • Uploaded using Trusted Publishing? No

File hashes

Hashes for singlem-0.8.0.tar.gz
Algorithm Hash digest
SHA256 6c0213990fd1ebb2a3c18b5bfa919143c0bdb53bbe9d53d4740e3206b9a151d2
MD5 58033fd17729ecfd6b28e309236f6894
BLAKE2b-256 178bf553c11bbb3e950516589aa26299b85098d0ac78405a4ebacefa023de306

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page