Skip to main content

Split Fasta

Split Fasta is a command-line tool which allows you to split the Fasta file with multiple sequences into individual Fasta files.

Installation

You can install Split Fasta from PyPI: pip install split-fasta

The Split Fasta works with Python 3.6 & above.

How to use?

The Split Fasta is a command-line tool, named splitfasta. To start it you have to go to the folder containing the Fasta file and then use the following syntax:- splitfasta filename.fasta

And it will split the combined Fasta file into individual files and save it into filename_split_files directory with names from filename_1 to filename_n.

It accepts only .fasta and .fa files where each sequence is separated by '>'

The example input file is :-

>ID-1
ATGGCTCGAGCACCCGAGGAAGTCGAAGGCGGAGCCCAAGAAGAAGCTCCACCCCTCGCACGAGGCGGTGTTCGAACGCT
>ID-2
ATGGCTCGAGCACCCGAGGAAGTCGAAGGCGGAGCCCAAGAAGAAGCTCCACCCCTCGCACGAGGCGGTGTTCGAACGCT

Detailed Tutorial

You can check out the detailed tutorial here

License

© 2020 Udit Vashisht

This repository is licensed under the MIT license. See LICENSE for details.

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

split-fasta-1.0.0.tar.gz (2.8 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

split_fasta-1.0.0-py3-none-any.whl (3.8 kB view details)

Uploaded Python 3

File details

Details for the file split-fasta-1.0.0.tar.gz.

File metadata

  • Download URL: split-fasta-1.0.0.tar.gz
  • Upload date:
  • Size: 2.8 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.2.0 pkginfo/1.5.0.1 requests/2.21.0 setuptools/49.6.0 requests-toolbelt/0.9.1 tqdm/4.31.1 CPython/3.7.2

File hashes

Hashes for split-fasta-1.0.0.tar.gz
Algorithm Hash digest
SHA256 8838a3bb9806a3cef7c2a1420df09712f732c3639e4427dc2615bae562e6f6d2
MD5 ca1fd4059a1bd6543398e4bc6357ea15
BLAKE2b-256 5cf16ccbaabb5d9bc1433db7829d3a8d06cdefc81be0ac2ad5732a47c92261f0

See more details on using hashes here.

File details

Details for the file split_fasta-1.0.0-py3-none-any.whl.

File metadata

  • Download URL: split_fasta-1.0.0-py3-none-any.whl
  • Upload date:
  • Size: 3.8 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.2.0 pkginfo/1.5.0.1 requests/2.21.0 setuptools/49.6.0 requests-toolbelt/0.9.1 tqdm/4.31.1 CPython/3.7.2

File hashes

Hashes for split_fasta-1.0.0-py3-none-any.whl
Algorithm Hash digest
SHA256 daa01523a72cc91def70f972b7ebd5a33061b3b1afe112494c6c9fdf5d968d37
MD5 4699794b30bda49ec3453cecf8ede320
BLAKE2b-256 a928d676560865ef5a69a1333a4e11d9009083cc773b338e89629fb0e137b09f

See more details on using hashes here.

Release history Release notifications | RSS feed

This release

1.0.0 This release

2 files

Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page