Split Fasta
Split Fasta is a command-line tool which allows you to split the Fasta file with multiple sequences into individual Fasta files.
Installation
You can install Split Fasta from PyPI:
pip install split-fasta
The Split Fasta works with Python 3.6 & above.
How to use?
The Split Fasta is a command-line tool, named splitfasta. To start it you have to go to the folder containing the Fasta file and then use the following syntax:-
splitfasta filename.fasta
And it will split the combined Fasta file into individual files and save it into filename_split_files directory with names from filename_1 to filename_n.
It accepts only .fasta and .fa files where each sequence is separated by '>'
The example input file is :-
>ID-1
ATGGCTCGAGCACCCGAGGAAGTCGAAGGCGGAGCCCAAGAAGAAGCTCCACCCCTCGCACGAGGCGGTGTTCGAACGCT
>ID-2
ATGGCTCGAGCACCCGAGGAAGTCGAAGGCGGAGCCCAAGAAGAAGCTCCACCCCTCGCACGAGGCGGTGTTCGAACGCT
Detailed Tutorial
You can check out the detailed tutorial here
License
© 2020 Udit Vashisht
This repository is licensed under the MIT license. See LICENSE for details.
1 maintainer
Metadata
1 maintainer
Release files for split-fasta 1.0.0
For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.
Source distribution (sdist)
| File | Size | Uploaded | Provenance | Actions |
|---|---|---|---|---|
| split-fasta-1.0.0.tar.gz | 2.8 kB | Without provenance | Details for split-fasta-1.0.0.tar.gz |
Built distribution (wheel)
| File | Interpreter | ABI | Platform | Actions Reset |
|---|---|---|---|---|
| split_fasta-1.0.0-py3-none-any.whl | Python 3 | none | any | Details for split_fasta-1.0.0-py3-none-any.whl |
Total release size: 6.6 kB
Release files / split-fasta-1.0.0.tar.gz
| Download URL | split-fasta-1.0.0.tar.gz |
|---|---|
| Size | 2.8 kB |
| Tags | Source |
|
SHA-256 checksum How to use checksums |
8838a3bb9806a3cef7c2a1420df09712f732c3639e4427dc2615bae562e6f6d2
|
|
BLAKE2b-256 checksum How to use checksums |
5cf16ccbaabb5d9bc1433db7829d3a8d06cdefc81be0ac2ad5732a47c92261f0
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/3.2.0 pkginfo/1.5.0.1 requests/2.21.0 setuptools/49.6.0 requests-toolbelt/0.9.1 tqdm/4.31.1 CPython/3.7.2
|
Release files / split_fasta-1.0.0-py3-none-any.whl
| Download URL | split_fasta-1.0.0-py3-none-any.whl |
|---|---|
| Size | 3.8 kB |
| Tags | Python 3 |
|
SHA-256 checksum How to use checksums |
daa01523a72cc91def70f972b7ebd5a33061b3b1afe112494c6c9fdf5d968d37
|
|
BLAKE2b-256 checksum How to use checksums |
a928d676560865ef5a69a1333a4e11d9009083cc773b338e89629fb0e137b09f
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/3.2.0 pkginfo/1.5.0.1 requests/2.21.0 setuptools/49.6.0 requests-toolbelt/0.9.1 tqdm/4.31.1 CPython/3.7.2
|
Security for split-fasta 1.0.0
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
No provenance found
None of the files in this release were uploaded with provenance metadata.
A note on package security
PyPI is a repository for distributing packages, not a service for auditing them. While third-party security researchers and our staff do their best to detect and remove malicious packages, PyPI cannot guarantee the quality, security or suitability of any given package.
To learn more about protecting yourself from malicious actors, visit our package security documentation.
