Split Fasta
Split Fasta is a command-line tool which allows you to split the Fasta file with multiple sequences into individual Fasta files.
Installation
You can install Split Fasta from PyPI:
pip install split-fasta
The Split Fasta works with Python 3.6 & above.
How to use?
The Split Fasta is a command-line tool, named splitfasta. To start it you have to go to the folder containing the Fasta file and then use the following syntax:-
splitfasta filename.fasta
And it will split the combined Fasta file into individual files and save it into filename_split_files directory with names from filename_1 to filename_n.
It accepts only .fasta and .fa files where each sequence is separated by '>'
The example input file is :-
>ID-1
ATGGCTCGAGCACCCGAGGAAGTCGAAGGCGGAGCCCAAGAAGAAGCTCCACCCCTCGCACGAGGCGGTGTTCGAACGCT
>ID-2
ATGGCTCGAGCACCCGAGGAAGTCGAAGGCGGAGCCCAAGAAGAAGCTCCACCCCTCGCACGAGGCGGTGTTCGAACGCT
Detailed Tutorial
You can check out the detailed tutorial here
License
© 2020 Udit Vashisht
This repository is licensed under the MIT license. See LICENSE for details.
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file split-fasta-1.0.0.tar.gz.
File metadata
- Download URL: split-fasta-1.0.0.tar.gz
- Upload date:
- Size: 2.8 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/3.2.0 pkginfo/1.5.0.1 requests/2.21.0 setuptools/49.6.0 requests-toolbelt/0.9.1 tqdm/4.31.1 CPython/3.7.2
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
8838a3bb9806a3cef7c2a1420df09712f732c3639e4427dc2615bae562e6f6d2
|
|
| MD5 |
ca1fd4059a1bd6543398e4bc6357ea15
|
|
| BLAKE2b-256 |
5cf16ccbaabb5d9bc1433db7829d3a8d06cdefc81be0ac2ad5732a47c92261f0
|
File details
Details for the file split_fasta-1.0.0-py3-none-any.whl.
File metadata
- Download URL: split_fasta-1.0.0-py3-none-any.whl
- Upload date:
- Size: 3.8 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/3.2.0 pkginfo/1.5.0.1 requests/2.21.0 setuptools/49.6.0 requests-toolbelt/0.9.1 tqdm/4.31.1 CPython/3.7.2
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
daa01523a72cc91def70f972b7ebd5a33061b3b1afe112494c6c9fdf5d968d37
|
|
| MD5 |
4699794b30bda49ec3453cecf8ede320
|
|
| BLAKE2b-256 |
a928d676560865ef5a69a1333a4e11d9009083cc773b338e89629fb0e137b09f
|