Skip to main content

DNA Sequence Visualization for Humans.

Project description

Squiggle

Build Status Cov CodeFactor Docs

Squiggle is a two-dimensional DNA sequence visualization library that can turn this:

>lcl|NC_000011.10_cds_NP_000509.1_1 [gene=HBB]
ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAG
TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG
GGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGT
GCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT
GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCA
TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT
GCCCTGGCCCACAAGTATCACTAA

into this:

Human Squiggle

Installation

Installation is as simple as:

$ pip install squiggle

Or alternatively, if you want to get the latest development version:

$ pip install git+https://github.com/Lab41/squiggle.git

Usage

Using squiggle is as easy as:

$ squiggle your_sequence.fasta

Squiggle has tons of options available to make beautiful, interactive visualizations of sequences. The full documentation is available here.

Citation

To be determined.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

squiggle-0.1.1.tar.gz (7.0 kB view details)

Uploaded Source

Built Distribution

squiggle-0.1.1-py2.py3-none-any.whl (6.5 kB view details)

Uploaded Python 2 Python 3

File details

Details for the file squiggle-0.1.1.tar.gz.

File metadata

  • Download URL: squiggle-0.1.1.tar.gz
  • Upload date:
  • Size: 7.0 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No

File hashes

Hashes for squiggle-0.1.1.tar.gz
Algorithm Hash digest
SHA256 b618d2846e7adb9fef5b624d28507c2b8527059e71cbaf66bcee1adc0d9347d6
MD5 d80c2fe969001d12c4f23cf7ca670caa
BLAKE2b-256 d71c1730ff2f99cb3ab490227484940b02ceedcfeef1888d8f37e3ffaf207405

See more details on using hashes here.

File details

Details for the file squiggle-0.1.1-py2.py3-none-any.whl.

File metadata

File hashes

Hashes for squiggle-0.1.1-py2.py3-none-any.whl
Algorithm Hash digest
SHA256 c67fe4f973856058e2a4a7ebe19a8935f542906083a6326322eb271df6e42489
MD5 441f853156f7dd17874d5fb10c0438b6
BLAKE2b-256 cb37fc4e34b6ee40764a76ce74470a6779a2db2ada6d148e7042dc88f0727116

See more details on using hashes here.

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page