Skip to main content

Nucleic acid thermodynamics, TMSD kinetics, and sequence design — the biophysics layer below mantis-delta

Project description

strider banner

strider-dna

Nucleic Acid Thermodynamics, Kinetics, and Circuit Design

Tests Python License: MIT

strider is a Python library for computing the thermodynamics and kinetics of DNA/RNA circuits. Given a set of strand sequences, it predicts free energies via nearest-neighbor parameters, folds secondary structures via dynamic programming, derives TMSD rate constants from the Zhang & Winfree (2009) empirical model, enumerates spurious leakage pathways, and produces kinetic rate dictionaries that drop directly into a mantis-delta CRNetwork. The full pipeline — sequence → thermodynamics → kinetics → reaction network → steady states / stochastic trajectories / bifurcation — runs end-to-end with zero external thermodynamic dependencies under an MIT license.

strider ships a two-backend thermodynamic engine that automatically selects the best available calculator: its own Zuker / McCaskill O(n³) DP (always available, MIT, sourced from SantaLucia 2004 + Mathews 1999 / Turner 2004 primary tables) or the ViennaRNA C library (optional, recommended for long sequences). The same API surface works with both — only ThermoEngine(backend=…) changes. Nearest-neighbor parameters live in a swappable ParameterSet that loads from Turner-style JSON files (built-in "native" set always available; user-supplied JSON discoverable via $STRIDER_PARAMS_DIR).

Beyond thermodynamics, strider provides a Tube / ComplexSet API for multi-strand equilibrium analysis (concentrations, free energies, lazy pair-probability matrices, ensemble defect — see §7), a circuit catalog of ready-made DSD templates (CHA, HCR, seesaw gates, translators) wrapped around a generic verification framework, a pure-thermo concentration solver matching standard Newton-on-chemical-potentials (Dirks et al. 2007) to numerical precision, Boltzmann sampling and suboptimal-structure enumeration on top of the partition function, an Assay / AssayPanel design abstraction for ensemble-defect minimization (built on top of the unified Complex primitive) plus a defect-weighted, parallel-tempered sequence designer with leaf decomposition and equilibrium-weighted objectives (see §8), a lightweight DSDCompiler for domain-level sequence assembly plus a DomainReactionEnumerator that derives a circuit's reaction network from strand topology (Peppercorn-style: bind / branch-migration / open → detailed-balance rates → CRN), and — via the companion mantis library — Gillespie SSA stochastic simulation in addition to deterministic ODE integration.


Table of contents

  1. Installation
  2. Core concepts
  3. Quick start
  4. Command-line interface
  5. User guide
  6. API reference
  7. Examples
  8. Backend comparison
  9. Running the tests
  10. Troubleshooting
  11. Background and theory
  12. Citation
  13. License

Installation

# Core library (native thermodynamic backend always included)
pip install strider-dna

# From source
git clone https://github.com/EmilioVenegas/strider
cd strider
pip install -e .

Optional backends:

pip install strider-dna[vienna]   # ViennaRNA backend (recommended for long sequences)
pip install strider-dna[mantis]   # mantis-delta integration (circuit templates, CRNetwork)
pip install strider-dna[pandas]   # SweepResult.to_dataframe()
pip install strider-dna[parallel] # ProcessPoolExecutor sweeps
pip install strider-dna[diff]     # PyTorch — gradient-based differentiable design
pip install strider-dna[full]     # all of the above

Requirements: Python ≥ 3.10, NumPy ≥ 1.24, SciPy ≥ 1.10, Matplotlib ≥ 3.6. PyTorch is not required for the core library — it is pulled in only by the [diff] (or [full]) extra, for the differentiable design API.

PyTorch is optional. Importing strider and using the full thermodynamics, design, tube, and circuit APIs works without PyTorch installed. Only the differentiable components — DifferentiableDesigner and DiffObjective — need it. They are imported lazily, so import strider never fails on a missing torch; accessing them without it raises a clear hint to pip install 'strider-dna[diff]'. See §16 Differentiable thermodynamics (PyTorch).

Note on import name: the PyPI distribution is strider-dna, but the Python package is imported as strider:

import strider
from strider import ThermoEngine, CHA, HCR, SeesawGate, Translator
from strider import Strand, Complex, SetSpec, ComplexSet, Tube, TubeResult, tube_analysis
from strider import Assay, AssayPanel, Assembly, DSDCompiler
from strider import ParameterSet, load_parameters
from strider import (
    SequenceDesigner, DesignObjective, HardConstraint,
    DefectWeightedPolicy, per_residue_defect_from_ensemble, decompose_assays,
)
from strider import solve_equilibrium, sample_structures, subopt_structures

Receipts

Concrete benchmark numbers, reproducible with python scripts/bench_accuracy.py:

Cohort Source strider native
11 canonical hairpins (Cheong 1990, Heus 1991, Antao 1991, Mathews 1999, SantaLucia 2004, Lu 2006) published dot-brackets mean F-measure 0.99, 10/11 exact match
toehold_kf, 0–12 nt Zhang & Winfree 2009 Fig. 4 0 % relative error
MFE wall-clock 20 nt ≈ 1.6 ms, 50 nt ≈ 35 ms, 100 nt ≈ 590 ms (single-thread pure Python)

The mean-F threshold is CI-enforced by tests/test_benchmarks.py, so accuracy regressions show up as a red test rather than as a missed claim.


Core concepts

Nearest-neighbor (NN) model

The standard model for DNA and RNA duplex thermodynamics. The free energy of a fully paired duplex is computed by summing stacking contributions from every adjacent dinucleotide pair (the "nearest neighbors") and adding initiation terms for the terminal bases. Parameters come from SantaLucia & Hicks (2004) for DNA and Mathews et al. (1999) for RNA. strider also includes Sugimoto et al. (1995) parameters for DNA:RNA hybrids.

Ensemble free energy and ΔΔG

ThermoEngine.pfunc(seq) returns the ensemble free energy ΔG = −RT ln Q, where Q is the partition function summed over all secondary structures weighted by their Boltzmann factors. This is more informative than the minimum free energy (MFE) alone because it accounts for the full structural ensemble.

The reaction free energy ΔΔG = ΣG(products) − ΣG(reactants) measures how thermodynamically driven a strand displacement reaction is. Negative ΔΔG means the reaction is spontaneous (products are lower energy).

Toehold-mediated strand displacement (TMSD)

A mechanism in which a short single-stranded overhang (the toehold) on a target strand initiates hybridization with an incoming strand, which then branch-migrates to displace the incumbent strand. Catalytic Hairpin Assembly (CHA) is built from a cascade of TMSD reactions. The forward rate constant kf depends sensitively on toehold length; Zhang & Winfree (2009) measured kf empirically for 0–12 nt toeholds in DNA.

Kinetic stability and the sweet spot

Hairpin kinetics for CHA have a "sweet spot": stems stable enough to suppress leakage (ΔG ≲ −6 kcal/mol) but not so stable that the toehold is buried (ΔG ≳ −12 kcal/mol). The CHA circuit template's verify() method checks this and several other design criteria via the generic CheckRegistry framework — easy to extend with custom checks for non-CHA topologies (HCR, SeesawGate, etc.).


Quick start

from strider import ThermoEngine, CHA, solve_equilibrium

# Create a thermodynamic engine (auto-selects best available backend)
engine = ThermoEngine(material='dna', celsius=37, sodium=0.137, magnesium=0.01)

# Fold a hairpin
result = engine.mfe('TCAACATCAGTCTGATAAGGAGGGAGGTTATCAGACTGA')
print(result.structure)   # '((((((......(((((((((((.)))))))))))....))))))'
print(result.energy)      # -7.8  kcal/mol

# Duplex binding free energy
ddg = engine.ddg(
    reactants=['TCAACATCAGTCTGATGTTGA', 'TCAACATCAGTCTGATAAGG'],
    products=[['TCAACATCAGTCTGATGTTGA', 'TCAACATCAGTCTGATAAGG']],
)
print(f"ΔΔG = {ddg:.2f} kcal/mol")  # ΔΔG = -8.3 kcal/mol

# Equilibrium concentrations of a 2-strand mix
res = solve_equilibrium(
    complexes={
        'A':  (['A'], 0.0),
        'B':  (['B'], 0.0),
        'AB': (['A', 'B'], -10.0),
    },
    totals={'A': 1e-7, 'B': 1e-7},
    celsius=37.0,
)
print(f"[AB] = {res.concentrations['AB']:.2e} M")  # ~4.0e-8

# Full CHA biosensor verification + mantis export
cha = CHA(
    sequences={
        'mirna': 'TAGCTTATCAGACTGATGTTGA',
        'H1':    'TCAACATCAGTCTGATAAGGAGGGAGGTTATCAGACTGA',
        'H2':    'TCAGTCTGATAAGGAGGGAGGTATCAGACTGATGTTGATTTTT',
        'CP':    'AAAAA',
    },
    engine=engine,
)
print(cha.verify())                  # pretty-printed CircuitReport
rn = cha.to_crnetwork()              # requires mantis-delta
sim = cha.simulate(                  # deterministic ODE
    {'mirna': 10e-9, 'H1': 100e-9, 'H2': 100e-9, 'CP': 100e-9}, (0, 7200),
)

Beyond CHA: replace CHA(...) with HCR(...), SeesawGate(logic='AND', ...), Translator(...), or roll your own subclass of CircuitTemplate. Every template has the same .verify(), .to_crnetwork(), .simulate(), .steady_states() surface.


Command-line interface

Installing strider registers a strider console script. Every subcommand takes --json for machine-readable output, and any sequence argument accepts - for stdin or @path for a file.

# MFE structure
$ strider fold GCGCAAAAGCGC
GCGCAAAAGCGC
((((....))))
ΔG = -2.350 kcal/mol  (4 bp)

# Ensemble ΔG (single- or multi-strand)
$ strider pfunc GCGCAAAAGCGC
ΔG_ens = -3.127 kcal/mol  (Z = 159.7, backend=native)

$ strider pfunc GCGCATGC GCATGCGC --backend vienna

# Duplex ΔG and melting temperature
$ strider duplex GCGCATGC                     # auto-uses reverse complement
$ strider duplex GCGCATGC GCATGCGC --sodium 0.05

# Tm only
$ strider melt GCGCATGCATGC --strand-conc 1e-7

# Co-transcriptional folding trajectory
$ strider cotx GGGAAACCCAAAGGG --min-length 5 --material rna
   5  .....              ΔG=+0.000
   ...
  15  (((...)))(((...))) ΔG=-2.240

# CHA / circuit verification from a JSON sequence spec
$ strider verify cha_spec.json

All commands accept --celsius, --material {dna,rna}, --sodium, --magnesium, and --backend where relevant. Run strider <cmd> --help for full options.


User guide

1. ThermoEngine and backends

ThermoEngine is the central dispatcher. Instantiate once and pass it through your analysis.

from strider import ThermoEngine

# Default is the native engine — strider's own, dependency-free, authoritative.
# 'auto' resolves to 'native' (it is never silently replaced by an external lib).
engine = ThermoEngine(material='dna', celsius=37, sodium=0.137, magnesium=0.01)

# Explicit backend
engine_0 = ThermoEngine(backend='native')    # default; always available, MIT-licensed
engine_v = ThermoEngine(backend='vienna')    # OPTIONAL cross-check only; must be requested

# Check what's available
print(ThermoEngine.available_backends())    # e.g. ['native'] or ['native', 'vienna']
print(engine.backend_name)                  # 'native' (unless you asked for 'vienna')

# Optional: load a specific nearest-neighbor parameter set
engine_p = ThermoEngine(material='dna', parameter_set='native-dna')
print(engine_p.params)                       # ParameterSet(name='native-dna', material='DNA', ...)

Persistent caching

Every mfe() and pfunc() call can be memoized to a SQLite database. Results are keyed by a SHA-256 hash of (operation, material, temperature, salt, sequences):

from strider import ThermoEngine, DiskCache

cache = DiskCache('~/.strider/my_project.db', max_size_mb=200, ttl_days=30)
engine = ThermoEngine(material='dna', celsius=37, cache=cache)

# First call computes; subsequent calls for the same inputs are instant
result = engine.mfe('ATCGATCG')
print(cache.stats())  # {'hits': 1, 'misses': 0, 'hit_rate': 1.0, 'entries': 1, ...}

ML correction hook

correction_model accepts any callable (sequence: str) → float that returns a ΔΔG correction (kcal/mol). This is added to every pfunc() result — useful for plugging in an empirically calibrated neural-network correction on top of the NN model:

my_model = lambda seq: -0.02 * seq.count('G')   # trivial example
engine = ThermoEngine(correction_model=my_model)

2. DNA / RNA thermodynamics

Duplex ΔG

from strider import ThermoEngine, duplex_dg, melting_temperature

# Via engine (uses backend-appropriate method)
engine = ThermoEngine()
dg = engine.duplex_dg('ATCGATCG', 'CGATCGAT')
print(f"ΔG = {dg:.2f} kcal/mol")       # ΔG = -7.4 kcal/mol

# Standalone NN function (DNA only, always native).
# Two-state ΔH−T·ΔS, with both [Na+] and [Mg2+] folded into the correction.
dg_nn = duplex_dg('ATCGATCG', celsius=37.0, sodium_M=0.137, magnesium_M=0.010)
print(f"ΔG (NN) = {dg_nn:.2f} kcal/mol")

# Melting temperature
tm = melting_temperature('ATCGATCG', strand_conc_M=250e-9, sodium_M=0.137)
print(f"Tm = {tm:.1f} °C")             # Tm = 26.3 °C

Hairpin intramolecular folding

# Single sequence → pfunc gives ensemble ΔG of all intramolecular structures
result = engine.pfunc('GGGAAACCC')
print(f"Ensemble ΔG = {result.free_energy:.2f} kcal/mol")
print(f"Partition function Q = {result.partition_function:.3e}")
print(f"Pair probability matrix shape: {result.pair_probs.shape}")   # (9, 9)

Hairpin melting temperature

A hairpin melts unimolecularly (folded ⇌ open), so its Tm is concentration-independent and is the temperature at which the folding free energy vanishes, Tm = ΔH / ΔS. strider derives both the ΔG and the Tm from the same engine: the Tm reuses the folding model's own ΔG₃₇ together with the SantaLucia stack enthalpies (the folding STACK table and the DNA_NN ΔH/ΔS agree to ≤0.015 kcal/mol — two views of the same SantaLucia 2004 set), so ΔG(Tm) = 0 by construction. There is no separate duplex-Tm path that can drift away from the reported folding ΔG.

from strider import hairpin_tm, hairpin_thermo, fraction_folded

seq = 'CTTTCAACACTGTTGCAGTAA'

# Tm at the experimental buffer (Mg²⁺ via the Tan-Chen salt model by default)
tm = hairpin_tm(seq, sodium_M=0.05, magnesium_M=0.010)
print(f"Tm = {tm:.1f} °C")                       # Tm = 40.1 °C

# Full two-state thermodynamics + the closed-state melt curve
th = hairpin_thermo(seq, sodium_M=0.05, magnesium_M=0.010)
print(f"ΔH = {th.dH:.1f}  ΔS = {th.dS:.1f}  ΔG₃₇ = {th.dG37:+.2f}")
print(f"folded fraction @37 °C = {fraction_folded(seq, 37, 0.05, 0.010):.2f}")

Two-state, single-hairpin only (bulges/multiloops raise ValueError — use pfunc for those). A hairpin Tm is hypersensitive to the ΔH/ΔS bookkeeping (a ~few-percent shift moves Tm by tens of °C), so treat the absolute value as calibratable against experiment rather than exact.

Mg²⁺ / salt model (Tan-Chen)

The hairpin Tm folds the salt dependence into the closed-state ΔG₃₇ before ΔS is derived. By default (salt_model="auto") stems ≥ 6 bp use the tightly-bound-ion (TBI) model of Tan & Chen (2007), which — unlike the per-base-pair correction used by the partition-function DP — is a whole-helix quantity that needs the stem length N. The mean electrostatic folding free energy per base stack is

Δg₁ = a₁ + b₁/N        (Na⁺)        a₁ = −0.07·ln[Na⁺] + 0.012·ln²[Na⁺],  b₁ = 0.013·ln²[Na⁺]
Δg₂ = a₂ + b₂/N²       (Mg²⁺)       a₂ = 0.02·ln[Mg²⁺] + 0.0068·ln²[Mg²⁺], b₂ = 1.18·ln[Mg²⁺] + 0.344·ln²[Mg²⁺]

(DNA coefficients; RNA coefficients also available). Mixed Na⁺/Mg²⁺ buffers combine the two by fractional weights with a cross-term,

x₁ = [Na⁺] / ([Na⁺] + (8.1 − 32.4/N)(5.2 − ln[Na⁺])[Mg²⁺]),   x₂ = 1 − x₁
Δg₁₂ = −0.6·x₁·x₂·ln[Na⁺]·ln((1/x₁ − 1)[Na⁺]) / N
ΔG₃₇(salt) = ΔG₃₇(1 M) + (N−1)(x₁Δg₁ + x₂Δg₂) + Δg₁₂

At 1 M Na⁺ / 0 Mg²⁺ every term is zero, so the 1 M reference Tm is unchanged. Stems below 6 bp (outside the fitted range, where 8.1 − 32.4/N degenerates) fall back to the per-base-pair dg_per_bp_salt. Force a model with salt_model="tan_chen" or "per_bp".

Why Tan-Chen: benchmarked against a panel of DNA molecular-beacon hairpins measured by qPCR melt (V. Rejtar data[^rejtar], 50 mM Na⁺, 2.25–10 mM Mg²⁺), Tan-Chen reproduces the experimental Mg²⁺ slope while the per-bp model under-shoots and the duplex-calibrated Owczarzy (2008) correction over-shoots ~3×:

Mg²⁺ Tm slope, 2.25→10 mM @ 50 mM Na⁺ °C/mM
Measured (qPCR melt, DNA beacons) ≈0.70
Tan-Chen 2007 (default) 0.71
per-base-pair dg_per_bp_salt 0.44
Owczarzy 2008 2.18

On the monovalent (Na⁺) axis all three agree within ~3 °C (e.g. ΔTm ≈ −14 °C at 50 mM vs 1 M), and Tan-Chen tracks ViennaRNA's independent salt model. Coefficients verified against Tan & Chen (2007) Eqs. 24–30.

Citation. Z.-J. Tan and S.-J. Chen, "RNA Helix Stability in Mixed Na⁺/Mg²⁺ Solution," Biophysical Journal 92(10):3615–3632 (2007). doi:10.1529/biophysj.106.100388. (Companion: Tan & Chen, Biophys. J. 90(4):1175–1190, 2006.)

[^rejtar]: Department of Biochemistry, Masaryk University.

Salt and temperature in the folding engine

The sodium, magnesium, and celsius you pass to ThermoEngine now propagate through the whole native folding path — MFE, the partition function, and the two-state duplex — not just the hairpin Tm. Both knobs are off by default at the 1 M Na⁺ / 0 Mg²⁺ / 37 °C reference, where results are bit-identical to the unsalted, ΔG₃₇ engine.

seq = 'GCGCAAAAGCGC'

# Salt: each closed base pair carries the per-bp correction dg_per_bp_salt =
# c·ln([Na⁺] + 3.4·√[Mg²⁺])  (c = −0.114 DNA, ×1.06 RNA; entropic, scales with T).
# MFE, pfunc, and duplex_dg all shift together.
for na, mg in [(1.0, 0.0), (0.05, 0.0), (0.05, 0.010)]:
    e = ThermoEngine('dna', sodium=na, magnesium=mg)
    print(f"[Na]={na} [Mg]={mg}: MFE={e.mfe(seq).energy:+.2f}  pfunc={e.pfunc(seq).free_energy:+.2f}")
# [Na]=1.0  [Mg]=0.0  : MFE=-3.25  pfunc=-3.44
# [Na]=0.05 [Mg]=0.0  : MFE=-1.88  pfunc=-2.21   ← lower salt destabilizes
# [Na]=0.05 [Mg]=0.010: MFE=-2.82  pfunc=-3.04   ← Mg²⁺ buys stability back

# Temperature: the engine extrapolates the *energy tables*, not just the R·T
# Boltzmann prefactor. Each parameter blends toward its enthalpy,
#   ΔG(T) = ΔG₃₇·(T/T_ref) + ΔH·(1 − T/T_ref),   T_ref = 310.15 K
# so ΔG(37 °C) = ΔG₃₇ exactly and colder = more stable. (At the 1 M reference,
# so the 37 °C value matches the salt example above and isolates temperature.)
for T in (25, 37, 55):
    e = ThermoEngine('dna', celsius=T, sodium=1.0, magnesium=0.0)
    print(f"T={T} °C: MFE={e.mfe(seq).energy:+.2f}")
# T=25 °C: MFE=-4.44   T=37 °C: MFE=-3.25   T=55 °C: MFE=-1.47

Provenance and scope of the temperature extrapolation:

  • DNA is the solid path: stack, mismatch, and tri-/tetraloop ΔH come from the SantaLucia 2004 / UNAFold .dh tables; loop-initiation ΔH is genuinely 0 (purely entropic, the UNAFold convention), so loop penalties scale as T/T_ref.
  • RNA loop-initiation ΔH is curated from Turner 2004 (ViennaRNA rna_turner2004.par) — and unlike DNA it is non-zero (hairpin 1.3/4.8/−2.9…, bulge 10.6/7.1…, interior −7.2/−1.3 kcal/mol). The generator validates each loop-size ΔG against strider's own tables before grafting the ΔH, so the two stay on the same model.
  • Dangles / terminal mismatches are temperature-resolved on both materials. For DNA they live on the external-loop stacking-ensemble decoration, computed as the standard all-dangles model from the literature dangle parameters (Bommarito et al. 2000) and re-Boltzmannised at T; for RNA they ride the parameter set with curated ΔH (Schroeder & Turner 2000). Both reduce to the 37 °C value exactly.
  • Salt is temperature-resolved too: the per-bp correction is entropic (counterion release), so ΔG_salt(T) = ΔG_salt(37 °C)·T/T_ref — the same ΔH = 0 law as DNA loop initiation (see Salt corrections below).
  • Still ΔH = ΔG₃₇ (small, no curated enthalpy): the exact small-interior-loop tables (interior_1_1/1_2/2_2), terminal penalty, coaxial stacking, multiloop, and asymmetry terms — temperature-independent until enthalpies are added.

The hairpin Tm path above uses the whole-helix Tan-Chen salt model; the folding engine here uses the per-base-pair dg_per_bp_salt (the quantity the McCaskill DP can apply pair-by-pair). They are two correct corrections for two different calculations — see Background → Salt corrections.

Reaction ΔΔG

engine.ddg() is the workhorse for pathway analysis. Each element of reactants / products is either a single sequence string (computed as a monomer) or a list of sequences (computed as a multi-strand complex):

mirna = 'TAGCTTATCAGACTGATGTTGA'
H1    = 'TCAACATCAGTCTGATAAGGAGGGAGGTTATCAGACTGA'

# ΔΔG for miRNA + H1 → miRNA·H1 complex
ddg_r1 = engine.ddg(
    reactants=[mirna, H1],
    products=[[mirna, H1]],   # list inside list = multi-strand complex
)
print(f"ΔΔG(R1) = {ddg_r1:.2f} kcal/mol")  # e.g. -8.5 kcal/mol

Toehold accessibility

The fraction of the ensemble in which all toehold positions are simultaneously unpaired — a direct measure of how accessible the toehold is for incoming strand binding:

# Check accessibility of the first 6 nt (the toehold) of H1
prob = engine.toehold_accessibility(H1, toehold_positions=list(range(6)))
print(f"Toehold accessible in {prob:.1%} of ensemble")

Salt corrections

Salt corrections for non-1M NaCl and Mg²⁺ are applied automatically when sodium ≠ 1.0 or magnesium > 0. Two distinct corrections are wired in:

  • Duplex / melting temperature — Owczarzy et al. (2004) for Na⁺ and Owczarzy et al. (2008) for Mg²⁺, with a mixed-ion regime from the √[Mg²⁺]/[Na⁺] ratio.
  • Partition function / ensemble ΔG — per-base-pair correction ΔG_per_bp(T) = c·ln([Na⁺] + 3.4·√[Mg²⁺])·T/T_ref kcal/mol, applied to each closed pair inside the McCaskill DP so it is automatically ensemble-weighted by the pair probability. c is an Owczarzy-style empirical fit (Owczarzy 2004/2008; Na⁺ ∈ [0.05, 1.0] M, Mg²⁺ ∈ [0, 0.1] M, ±0.005 kcal/mol/bp): −0.114 for DNA, ×1.06 for RNA (the Tan & Chen 2007 RNA/DNA per-stack ratio — RNA's tighter A-form helix gives ~6 % stronger counterion release). The dependence is entropic (counterion release, ΔH_salt ≈ 0), so it scales with absolute temperature. See strider.thermo.salt.dg_per_bp_salt.

The two formulas serve different purposes (Tm uses the original Owczarzy Tm-shift form; pfunc needs a per-pair ΔG that integrates over the structural ensemble). Both reduce to zero at 1 M Na⁺ / 0 Mg²⁺ — the SantaLucia/Turner reference state — for every temperature.

Chemical modifications (LNA, 2′OMe, PS)

from strider import ModificationSite, apply_modifications

dg_unmod = engine.duplex_dg('ATCGATCG')

mods = [
    ModificationSite(position=0, mod_type='LNA'),   # +L at position 0
    ModificationSite(position=7, mod_type='LNA'),   # +L at position 7
]
dg_mod = apply_modifications(dg_unmod, 'ATCGATCG', mods)
print(f"ΔΔG(modification) = {dg_mod - dg_unmod:.2f} kcal/mol")  # ~-3.0

3. Secondary structure prediction

MFE structure

from strider import fold_mfe, ThermoEngine

# Standalone Zuker-style DP (native backend)
structure, energy, pairs = fold_mfe('GGGAAATTTCCC', celsius=37.0, material='dna')
print(structure)    # '((((....))))'
print(energy)       # -2.8 kcal/mol
print(pairs)        # [(0, 11), (1, 10), (2, 9), (3, 8)]

# Via engine (uses configured backend)
engine = ThermoEngine()
result = engine.mfe('GGGAAATTTCCC')
print(result.structure, result.energy, result.base_pairs)

Pseudoknots

fold_pseudoknot() extends the standard MFE algorithm to consider H-type pseudoknots (the most common class in biosensor contexts). It uses a restricted Rivas & Eddy (1999) grammar at O(n⁴) time:

from strider import fold_pseudoknot

structure, energy, pairs = fold_pseudoknot('GGGCCCTTTGGGCCC')
# structure uses () for normal pairs, [] for pseudoknot pairs
print(structure)    # e.g. '(((....[[)))....]]]'

Co-transcriptional folding

fold_cotranscriptional() sweeps prefix lengths and folds each one, returning the trajectory of structures the strand passes through while being transcribed. This matters for riboswitches, aptamers, and any RNA whose biology depends on a kinetic intermediate rather than the final MFE:

from strider import fold_cotranscriptional

traj = fold_cotranscriptional('GGGAAACCCAAAGGG', material='rna', min_length=5)
for p in traj.prefixes:
    print(f'{p.length:>3}  {p.structure}  ΔG={p.energy:+.2f}')

# Detect where existing pairs broke as 3' sequence arrived
print(traj.rearrangements())   # e.g. [(9, 12)] — refold between length 9 and 12
print(traj.final().structure)  # fully-transcribed MFE

step=N subsamples every Nth prefix for long sequences. The full-length prefix is always included regardless of step.

Dot-bracket parsing and analysis

from strider import parse_pairs, to_dot_bracket, validate
from strider.structure.dot_bracket import stem_regions, unpaired_positions

structure = '(((...)))'
pairs = parse_pairs(structure)          # [(0, 8), (1, 7), (2, 6)]
rebuilt = to_dot_bracket(pairs, 9)     # '(((...)))'
print(validate('(((...)))'))           # True
print(validate('(((...))'))            # False (mismatched)

stems = stem_regions(structure)        # [(0, 8, 3)] — one stem of length 3
unpaired = unpaired_positions(structure)  # [3, 4, 5]

Mountain representation

The mountain plot encodes the nesting depth at each position — a compact fingerprint for comparing structures:

from strider import mountain_vector, compare_structures

m = mountain_vector('(((...)))')      # array([0, 1, 2, 2, 2, 2, 2, 1, 0])
dist = compare_structures('(((...)))', '((.......))')  # L1 distance, range [0, 1]
print(f"Structure distance: {dist:.3f}")

4. Boltzmann sampling and subopt enumeration

When the MFE structure alone misrepresents the ensemble (e.g. competing folds within a few kcal/mol of the optimum), two routines on top of the partition function help inspect what's really happening.

Boltzmann sampling

Draw n structures distributed according to their equilibrium probabilities (Ding & Lawrence 2003, stochastic traceback over the Qb/Q/QM matrices):

from strider import sample_structures
from collections import Counter

samples = sample_structures('GCGCGCAAAAGCGCGC', n_samples=100, seed=0)
counts = Counter(db for db, _ in samples)
for db, n in counts.most_common(5):
    print(f"{n:3d}  {db}")
# 78  ((((((....))))))      ← MFE dominates for a strong hairpin
#  9  ............
#  5  (((((......))))).
#  ...

Suboptimal-structure enumeration

Enumerate all structures within gap kcal/mol of the MFE (Wuchty-style worklist over the V/W matrices, energy-pruned):

from strider import subopt_structures

for db, e, _ in subopt_structures('GCGCAAAAGCGC', gap=3.0, max_structures=20):
    print(f"{e:7.3f}  {db}")
# -2.350  ((((....))))
# -0.110  .(((....))).
# -0.010  (((......)))
#  0.000  ............

Both procedures are also exposed as engine methods (engine.sample(seq, n) and engine.subopt(seq, gap)) for use inside design objectives.


5. TMSD kinetics

Toehold rate constants

toehold_kf() uses the Zhang & Winfree (2009) empirical lookup table at 25 °C and applies an Arrhenius correction to the target temperature (Ea ≈ 20 kcal/mol for DNA TMSD):

from strider import toehold_kf, displacement_kf, leakage_kf, rates_from_ddg

# Forward rate at 37 °C for a 6-nt toehold
kf = toehold_kf(n_nt=6, material='dna', celsius=37.0)
print(f"kf = {kf:.2e} M⁻¹ s⁻¹")      # kf ≈ 5.5e5 M⁻¹ s⁻¹

# Derive reverse rate from ΔΔG and detailed balance
kf_val, kr_val = rates_from_ddg(ddg=-8.5, kf=kf, celsius=37.0)
print(f"kr = {kr_val:.2e} s⁻¹")

# Boltzmann-suppressed leakage rate (hairpin breathing model)
k_leak = leakage_kf(stem_stability_kcal=7.5)
print(f"k_leak = {k_leak:.2e} M⁻¹ s⁻¹")   # ≪ kf

TMSDKineticModel — full circuit rates

TMSDKineticModel computes ΔΔG internally from the ThermoEngine and returns mantis-compatible rate dictionaries:

from strider import ThermoEngine, TMSDKineticModel

engine = ThermoEngine(material='dna', celsius=37, sodium=0.137, magnesium=0.01)
model = TMSDKineticModel(engine)

# Compute rates for a single reaction
rate_set = model.reaction_rates(
    reactant_seqs=['TAGCTTATCAGACTGATGTTGA', 'TCAACATCAGTCTGATAAGG'],
    product_seqs=[['TAGCTTATCAGACTGATGTTGA', 'TCAACATCAGTCTGATAAGG']],
    toehold_length=6,
    mechanism='toehold_binding',
)
print(rate_set)
# TMSDRateSet(kf=5.5e5, kr=2.1e-3, k_eq=2.6e8, ddg=-8.5, toehold_length=6, ...)

# Build a full mantis-compatible rate dict for a circuit
reactions = [
    "mirna + H1 <-> mirna_H1",
    "mirna_H1 + H2 <-> H1H2 + mirna",
]
sequences = {
    'mirna': 'TAGCTTATCAGACTGATGTTGA',
    'H1':    'TCAACATCAGTCTGATAAGG...',
    'H2':    'TCAGTCTGATAAGGA...',
}
rates = model.circuit_rates(reactions, sequences, toehold_map={"mirna + H1 <-> mirna_H1": 6})

Arrhenius utilities

from strider import arrhenius, detailed_balance_kr, k_eq_from_ddg, ddg_from_k_eq

# Scale a rate constant between temperatures
kf_50 = arrhenius(k_ref=5.5e5, ea_kcal=20.0, T_ref_K=298.15, T_K=323.15)

# Derive reverse rate from ΔΔG
kr = detailed_balance_kr(kf=5.5e5, ddg_kcal=-8.5, celsius=37.0)

# Convert between ΔΔG and Keq
keq = k_eq_from_ddg(-8.5, celsius=37.0)   # ≈ 9.6e5
ddg = ddg_from_k_eq(keq, celsius=37.0)    # ≈ -8.5

6. Leakage enumeration

LeakageEnumerator systematically checks all pairwise (and optional tripartite) strand combinations for thermodynamically favorable spurious complexes:

from strider import ThermoEngine, LeakageEnumerator

engine = ThermoEngine()
enumerator = LeakageEnumerator(
    engine,
    ddg_threshold=-4.0,      # report reactions with ΔΔG < -4 kcal/mol
    max_complex_size=3,       # check pairs and triplets
    max_pathways=100,
)

strands = {
    'H1': 'TCAACATCAGTCTGATAAGG...',
    'H2': 'TCAGTCTGATAAGGAG...',
    'CP': 'AAAAA',
}

report = enumerator.enumerate(
    strands,
    intended_reactions=["H1 + H2 <-> H1H2"],  # exclude known-intended reactions
)

print(report)
# LeakageReport(3 spurious reactions, worst ΔΔG=-5.82 kcal/mol)

for rxn in report.reactions:
    print(rxn.mantis_string, f"  ΔΔG={rxn.ddg:.2f}")

# Filter to only the worst offenders
critical = report.filter(ddg_threshold=-5.0)

# Export as mantis reaction strings
mantis_strings = report.to_mantis_strings()

Each SpuriousReaction has a pathway_type classifying it as "hybridization", "displacement", or "cooperative".


7. Multi-strand tube analysis

The high-level Tube API answers the question "given these strands at these total concentrations, what does the equilibrium ensemble look like?" The pipeline:

  1. Wrap each sequence in a Strand(name, sequence, material).
  2. Describe which complexes can form via a ComplexSet with a SetSpec (max stoichiometry plus optional include/exclude rules).
  3. Build a Tube(strand_totals, complexes).
  4. Call tube.analyze(engine) (or tube_analysis([tube1, tube2, ...], engine)).
  5. Inspect TubeResult.concentrations, .free_energies, .strand_free, plus lazy .pair_probabilities(name) and .defect(name, target_structure).
from strider import Strand, ComplexSet, SetSpec, Tube, ThermoEngine

H1 = Strand("H1", "GCAGTGAGACGAGCTGCT", material="dna")
H2 = Strand("H2", "AGCAGCTCGTCTCACTGC", material="dna")

engine = ThermoEngine(material="dna", celsius=37, sodium=0.137, magnesium=0.01)

tube = Tube(
    strand_totals={H1: 1e-6, H2: 1e-6},
    complexes=ComplexSet([H1, H2], SetSpec(max_size=2)),  # monomers + all dimers
    name="biosensor",
)
result = tube.analyze(engine)

for species, conc in sorted(result.concentrations.items(),
                             key=lambda kv: -kv[1]):
    print(f"{species:6s}  ΔG = {result.free_energies[species]:+7.2f}  [X] = {conc:.2e} M")

# Lazy: pair-probability matrix and ensemble defect only computed on demand.
P = result.pair_probabilities("H1_H2")
d = result.defect("H1", "((((....))))")

SetSpec controls enumeration:

SetSpec(max_size=2)                                   # all complexes ≤ 2 strands
SetSpec(max_size=3)                                   # plus trimers
SetSpec(max_size=2, exclude=[Complex.from_names(["H1", "H1"])])  # drop homodimer
SetSpec(max_size=0, include=[                          # only explicit complexes
    Complex.from_names(["H1", "H2"], name="signal"),
])

Complex is canonicalized by sorted strand names, so Complex(strands=(H1, H2)) and Complex(strands=(H2, H1)) are the same chemical species. The cyclic-rotation symmetry number σ (Dirks et al. 2007 eq. 11) is exposed at cx.sigma and applied automatically inside the engine's pfunc.

Low-level solver

solve_equilibrium() is the underlying convex-dual Newton solver if you want to skip the Tube wrapper (e.g. you already have per-complex ΔG values from somewhere else):

from strider import solve_equilibrium

res = solve_equilibrium(
    complexes={
        "A":  (["A"],      0.0),
        "B":  (["B"],      0.0),
        "AB": (["A", "B"], -10.0),     # ΔG of the dimer (kcal/mol, 1 M standard)
    },
    totals={"A": 1e-7, "B": 1e-7},
    celsius=37.0,
)
print(res.converged, res.iterations, res.residual)
print(res.concentrations)              # {'A': 6.0e-8, 'B': 6.0e-8, 'AB': 4.0e-8}

If your input ΔG comes from a tool using a non-1 M reference state (e.g. water-molarity at ~55 M), pass standard_state_M=water_molarity(celsius) so the solver applies the corresponding (N − 1)·RT·ln(c₀) shift per N-strand complex.

The legacy equilibrium_from_engine(engine, strands_dict, totals, max_size=N) is preserved as a thin wrapper over Tube.analyze — keep it for backward compat, prefer the Tube API for new code.

Rotational symmetry

cyclic_symmetry(strand_list) returns the cyclic-symmetry number σ used to correct homomeric multi-strand pfunc values. ThermoEngine.pfunc and Complex.sigma already use it under the hood so that every backend reports species-level (not ordered-complex) ΔG.


8. Sequence design and the Assay abstraction

SequenceDesigner minimizes a composable DesignObjective using simulated annealing. Free domains are optimized; fixed domains (e.g. the miRNA binding site) are held constant.

from strider import ThermoEngine, SequenceDesigner, DomainSpec, DesignObjective, HardConstraint

engine = ThermoEngine()

# Specify domains: free vs fixed
domains = {
    'toehold':  DomainSpec(length=6, material='dna'),                 # free
    'stem':     DomainSpec(length=11, material='dna'),                # free
    'binding':  DomainSpec(sequence='TAGCTTATCAGACTGATGTTGA'),        # fixed
}

# Compose objective: target ΔΔG for binding + hairpin stability
objective = (
    DesignObjective.ddg_target(engine, ['binding'], [['binding', 'stem']], target=-9.0, weight=2.0)
    + DesignObjective.gc_content('toehold', target_gc=0.5, weight=1.0)
    + DesignObjective.minimize_leakage(engine, ['toehold', 'stem'], threshold=-4.0, weight=0.5)
)

# Hard constraints: no AAAA runs, GC content between 40–60%
constraints = [
    HardConstraint.max_run(max_run_length=4),
    HardConstraint.gc_content(min_gc=0.4, max_gc=0.6),
]

designer = SequenceDesigner(engine, seed=42)
result = designer.design(
    domains,
    objective,
    hard_constraints=constraints,
    n_trials=10,
    max_iterations=500,
)

print(result)
# DesignResult(score=0.0312, iterations=500, seqs=['toehold', 'stem', 'binding'])
print(result.sequences)
print(result.objective_breakdown)

Built-in objectives

Factory method What it penalizes
DesignObjective.ddg_target(engine, reactants, products, target) (ΔΔG − target)²
DesignObjective.ddg_range(engine, reactants, products, min, max) ΔΔG outside [min, max]
DesignObjective.minimize_leakage(engine, strand_names, threshold) Pairwise ΔΔG below threshold
DesignObjective.toehold_accessible(engine, strand_name, positions, min_prob) Low toehold accessibility
DesignObjective.ensemble_defect(engine, strand_names, target_structure) Normalized expected mispaired nucleotides vs target dot-bracket (Zadeh 2011) — NUPACK complex_design
DesignObjective.multitube_defect(engine, tubes, tube_weights=None) Weighted sum of the test-tube ensemble defect (structural + concentration defect) over N tubes — NUPACK tube_design (1 tube) / multistate design (N tubes); see below
DesignObjective.gc_content(strand_name, target_gc) (GC − target)²
DesignObjective.from_callable(fn) Any Python callable returning a float

Multistate / multi-tube design (multitube_defect). This is the equilibrium-aware analogue of ensemble_defect, matching NUPACK's tube_design and multistate test-tube design. Each tube is given as (tube_factory, on_targets), where tube_factory(seqs) → Tube rebuilds the tube from the current sequences and on_targets is a list of (complex_canonical_name, target_dot_bracket, target_concentration_M). For every tube the optimizer runs a real equilibrium solve and scores the normalized test-tube ensemble defect TubeResult.tube_ensemble_defect:

C_tube = ( Σ_h c_h·ñ(h, s_h)  +  Σ_h |h|·max(0, c_h* − c_h) ) / ( Σ_h |h|·c_h* )
          └── structural defect ──┘   └── concentration defect ──┘

The structural term is each on-target complex's equilibrium concentration c_h times its unnormalized ensemble defect; the concentration term penalizes on-target material that failed to form at its target concentration c_h* because the strands were sequestered in off-targets. Off-targets need no explicit list or ΔΔG threshold — they are simply every non-on-target complex in the tube, and the equilibrium solve has already distributed strands among them. The multi-tube objective is Σ_t tube_weights[t]·C_tube(t), so a single tube reproduces tube_design and several tubes give true multistate design. A tube whose solve raises contributes +inf (the SA move is rejected).

Dynamical (closed-loop) objectives. These factories drive optimization from a kinetic cost: each evaluation rebuilds a mantis CRNetwork via the caller-supplied network_factory: (seqs) → CRNetwork (typically a closure over CircuitBridge.to_crnetwork or a circuit template's .to_crnetwork) and runs an ODE simulation or bifurcation scan before returning a scalar. They compose with the static objectives under the same + / * protocol.

Factory method What it penalizes
DesignObjective.kinetic_trajectory(factory, ic, target_curve, times) Normalized MSE between simulated and target concentration trajectories
DesignObjective.maximize_kcat(factory, species, ic, t_window) −Δ[species]/Δt (drives the catalytic production rate up)
DesignObjective.minimize_leak(factory, signal, ic_no_trigger, t_window, threshold) (log10(leak / threshold))² for a no-trigger control sim above threshold
DesignObjective.bistable_threshold(factory, parameter, range, species, target) (log10(threshold_actual / target))² at the bifurcation-scan crossing
DesignObjective.from_simulation(factory, ic, t_span, cost_fn) Escape hatch — arbitrary cost_fn(SimulationResult) → float

See examples/09_dynamical_design.py for a complete pipeline; the spec behind these factories is item 1 of outperform_nupack.md (closed-loop dynamical sequence design).

Objectives compose with + and scale with *:

total = 2.0 * objective_a + objective_b + 0.5 * objective_c

Built-in hard constraints

Factory method What it enforces
HardConstraint.no_repeats(motifs) Forbid specified sequence motifs
HardConstraint.gc_content(min_gc, max_gc) GC fraction in [min, max]
HardConstraint.no_self_complement(min_length) No self-complementary run ≥ min_length
HardConstraint.iupac_pattern(strand_name, pattern, start) IUPAC code match at offset
HardConstraint.max_run(max_run_length) No homopolymer run > max_run_length
HardConstraint.min_length(length) Minimum sequence length
HardConstraint.from_callable(fn) Any (name, seq) → bool

Assay / AssayPanel — high-level design intent

For circuit-level design, Assay bundles a set of on-target assemblies (each with its dot-bracket target and expected concentration) plus off-target assemblies that must not form. It compiles into a DesignObjective that the designer minimizes:

from strider import Assay, AssayPanel, Assembly, SequenceDesigner, DomainSpec

assay = Assay(
    name='hairpin_sensor',
    on_targets=[
        Assembly('H', ['H'], '((((....))))', concentration=1e-7),
    ],
    off_targets=[
        Assembly('H_H', ['H', 'H']),       # forbid homodimer
    ],
    off_target_ddg_threshold=-4.0,         # penalize binding stronger than this
)

designer = SequenceDesigner(engine, seed=0)
result = designer.design(
    domains={'H': DomainSpec(length=12)},
    objective=assay.to_objective(engine),
    n_trials=4,
    max_iterations=200,
)

An AssayPanel sums multiple Assay objectives so you can design across several test tubes at once:

panel = AssayPanel(assays=[assay_low_temp, assay_high_temp])
objective = panel.to_objective(engine)

Defect-weighted mutation sampling and parallel tempering

For objectives dominated by ensemble defect (anything compiled from an Assay on-target, or DesignObjective.ensemble_defect), uniform-random base flips waste most of their proposals on already-satisfied positions. The DefectWeightedPolicy biases site selection by the per-residue defect vector — positions whose target pair is poorly satisfied get flipped more often — and is the recommended default for any defect-driven task:

from strider import (
    DefectWeightedPolicy, per_residue_defect_from_ensemble, SequenceDesigner,
    DomainSpec, DesignObjective, ThermoEngine,
)

engine = ThermoEngine(material="dna")
target = "((((....))))"
objective = DesignObjective.ensemble_defect(engine, ["H"], target)

# Per-residue defect = 1 − P_correct(i) under McCaskill (Zadeh, Wolfe & Pierce 2011)
defect_fn = per_residue_defect_from_ensemble(engine, ["H"], target)
policy = DefectWeightedPolicy(defect_fn=defect_fn)

designer = SequenceDesigner(engine, seed=0)
result = designer.design(
    domains={"H": DomainSpec(length=12)},
    objective=objective,
    n_trials=3,
    max_iterations=5000,
    mutation_policy=policy,
    parallel_tempering=True,    # geometric T_end → T_start ladder of chains
    n_chains=4,
    swap_every=20,
)

Parallel tempering runs n_chains Metropolis chains in parallel on a geometric temperature ladder; every swap_every steps adjacent chains attempt a swap. Hot chains hop between basins; the cold chain captures the global minimum. Early rejection via DomainSpec(length=L, gc_band=(0.3, 0.7)) skips out-of-band candidates before the (expensive) objective evaluation. HardConstraint.propose(name, seq, pos, rng, bases) lets the designer route base-flip generation through a constraint when one provides a proposer, instead of relying on reject-after-the-fact filtering — the ConstraintAwarePolicy wrapper opts into this behaviour.

Equilibrium-weighted Assay objective

By default Assay.to_objective(engine) weights each on-target defect by the user-declared Assembly.concentration. Passing equilibrium=True instead runs a Tube.analyze solve over the union of all declared assemblies and weights every on-target by its true post-equilibrium concentration:

obj = assay.to_objective(engine, equilibrium=True)

This is more expensive (one Newton solve per objective evaluation) but captures composition shifts — large off-target stability eats into the on-target weight automatically.

Leaf decomposition

A multi-strand design panel whose assemblies decompose into disjoint strand subsets can be optimised one leaf at a time. decompose_assays(...) splits an Assay (or AssayPanel) into the smallest independent sub-assays based on strand-graph connected components:

from strider import decompose_assays

leaves = decompose_assays(assay_panel)
for leaf in leaves:
    designer.design(...leaf-specific domains..., objective=leaf.to_objective(engine))

Strands that appear in any pair of assemblies stay in the same leaf, so off-target penalties continue to constrain the structures they target.

Design benchmark CLI

python scripts/bench_design.py --iterations 2000 --trials 3
# hairpin-12      defect=0.0591  floor=0.06  iters=2000  wall=2.6s
# hairpin-20      defect=0.0789  floor=0.04  iters=2000  wall=12.4s
# duplex-12       defect=0.1575  floor=0.10  iters=2000  wall=24.0s

The runner exercises the canonical hairpin / duplex tasks defined in strider.design.benchmarks. The reported floors are the lowest defects achievable with the native McCaskill DP at each length — convergence of "≤ 2× the floor" is the realistic target on a pure-Python engine.


9. Mutation sensitivity analysis

MutationAnalyzer computes how each nucleotide position contributes to a thermodynamic metric by exhaustively scanning all single-nucleotide mutations:

from strider import ThermoEngine, MutationAnalyzer

engine = ThermoEngine()
analyzer = MutationAnalyzer(engine)

profile = analyzer.single_nt_scan(
    sequence='TCAACATCAGTCTGATAAGG',
    target='TAGCTTATCAGACTGATGTTGA',   # hybridization partner
    tolerance=1.0,                      # kcal/mol tolerance for robustness
)

print(f"Robustness: {profile.robustness:.1%}")         # fraction of mutations within tolerance
print(f"Critical positions: {profile.critical_positions(threshold=2.0)}")

# Heatmap visualization
profile.plot(title="H1 mutation sensitivity")

profile.max_sensitivity gives the worst-case ΔΔG over all three possible mutations at each position — useful for identifying positions that must be preserved.


10. Off-target screening

OffTargetScreener screens a probe sequence against a reference database (FASTA) using k-mer pre-filtering followed by full ΔΔG evaluation:

from strider import ThermoEngine, OffTargetScreener

engine = ThermoEngine()
screener = OffTargetScreener(engine, reference_db='mirbase_hsa.fa', kmer_k=7)

report = screener.screen(
    sequence='TCAACATCAGTCTGATAAGG',
    n_top=10,
    ddg_threshold=-4.0,
)

print(report)
# ScreeningReport(query=TCAACATCAGTC..., hits=2, specific=False)
for hit in report.hits:
    print(f"  {hit.name}  ΔΔG={hit.ddg:.2f}  shared_kmers={hit.k_score}")

# Direct selectivity comparison against a family
selectivity = screener.specificity_vs(
    sequence='TCAACATCAGTCTGATAAGG',
    family_members=[miR21_alt1, miR21_alt2, miR155],
    target='TAGCTTATCAGACTGATGTTGA',
)
# {miR21_alt1: +1.2, miR21_alt2: +2.4, miR155: +5.8}  (positive = more selective)

You can also add sequences in-memory without a FASTA file:

screener.add_sequences({'miR155': 'UUAAUGCUAAUUGUGAUAGGGGU'})

11. Circuit catalog and the mantis bridge

strider ships a catalog of DSD circuit templates under strider.circuits. All templates share the same API: a strand set, a reaction topology, a toehold map, and a default check suite. Each emits a CircuitBridge for use with the mantis simulator.

from strider import CHA, HCR, SeesawGate, Translator

CHA — Catalytic Hairpin Assembly

cha = CHA(
    sequences={
        'mirna': 'TAGCTTATCAGACTGATGTTGA',
        'H1':    'TCAACATCAGTCTGATAAGGAGGGAGGTTATCAGACTGA',
        'H2':    'TCAGTCTGATAAGGAGGGAGGTATCAGACTGATGTTGATTTTT',
        'CP':    'AAAAA',
    },
    toehold_d1=6,    # miRNA·H1 toehold length
    toehold_d2=11,   # H2 branch migration domain
    tail_cp=9,       # CP tail length
)

CHA as a generatorfrom_target and design

The constructor above checks sequences you already have. CHA can also build them from a target. from_target lays out the domains (the target's 3′ end is the initiation toehold D1, the adjacent block the branch-migration stem D2, plus a hairpin loop and an optional orthogonal capture handle K → CP = K*) and assembles ready-to-verify() strands:

cha = CHA.from_target(
    'UAGCUUAUCAGACUGAUGUUGA',          # target (RNA or DNA)
    d1_len=7, d2_len=13,
    loop='ACTTAATTAAGT',
    capture='ACGATCAGTCATGCAACGTA',     # K (CP = reverse complement)
)
report = cha.verify()                    # round-trips with the checker

design goes further: it searches for the split, loop, and capture handle. It scans d1_grid × d2_grid × loops, ranks each combo by a cascade-gate penalty (R1/R2 driving force, toehold accessibility, hairpin-stability sweet-spot), then for the top rerank_top_n combos designs an orthogonal handle K with SequenceDesigner and re-ranks on the post-capture gate — the R2 measured with K attached to H1, which is what validation actually gates on, not the bare-hairpin proxy:

cha = CHA.design(
    'UAGCUUAUCAGACUGAUGUUGA',
    d1_grid=(6, 7, 8), d2_grid=(11, 13, 15),
    capture_len=20, rerank_top_n=3,
    n_trials=3, max_iterations=120,
)
print(cha.design_info['context'])        # chosen (d1, d2, loop)
rn = cha.to_crnetwork()                   # straight into mantis

Two reusable pieces underpin design, both usable on their own for any circuit:

  • DesignObjective.reaction_driving_force(engine, reactants, products, max_ddg, assemble_fn=…) — a coupling constraint: penalize a reaction whose driving force drifts above a gate while the optimizer tunes a different domain. assemble_fn builds the full strands so the gate is measured on the assembled context (e.g. the handle attached to H1), not the bare domain. This is the design-time mirror of the reaction_driving_force check.
  • design_with_rerank(designer, contexts, build_problem, score_fn, top_n=3) — design the top-N pre-ranked contexts and pick the winner by a downstream score_fn evaluated on the finished design (the gate-with-downstream value), rather than trusting the pre-rank proxy.

HCR — Hybridization Chain Reaction

hcr = HCR(
    sequences={'I': '...', 'H1': '...', 'H2': '...'},
    toehold_initiator=6,
    toehold_branch=6,
)

SeesawGate — Qian-Winfree compute primitive (YES / AND / OR / NOT)

gate = SeesawGate(
    logic='AND',
    sequences={
        'Input1': '...', 'Input2': '...',
        'Gate': '...', 'Threshold_Input1': '...',
        'Threshold_Input2': '...', 'Fuel': '...', 'Output': '...',
    },
    toehold=6,
)

Translator — input strand X triggers release of output strand Y

tr = Translator(
    sequences={'X': '...', 'Y': '...', 'Gate': '...'},
    toehold_x=6,
)

Verification via CheckRegistry

Every template has a verify() method that runs its default check suite and returns a structured CircuitReport:

report = cha.verify()
print(report)
CHA: PASS
  ✓ toehold_accessible: 0.996 (prob) — unpaired probability 1.00 (≥ 0.50)
  ✓ H1_stability: -5.07 kcal/mol — normalised ΔG -5.07 kcal/mol (in [-12, -4])
  ✓ H2_stability: -4.51 kcal/mol — normalised ΔG -4.51 kcal/mol (in [-12, -4])
  ✓ R1_driving_force: -10.54 kcal/mol — ΔΔG -10.54 kcal/mol (≤ -3.0)
  ✓ R2_driving_force: -12.89 kcal/mol — ΔΔG -12.89 kcal/mol (≤ -3.0)
  ✓ R3_driving_force: -9.56 kcal/mol — ΔΔG -9.56 kcal/mol (≤ -8.0)
  ✓ CP_leakage: -5.14 kcal/mol — ΔΔG -5.14 kcal/mol (≥ -6.0)
  ✓ spontaneous_leakage: 1.49e-07 ratio — leak/signal = 1.49e-07 (≤ 1e-04)

Build your own checks with CheckRegistry:

from strider import CheckRegistry, stability_in_range, no_spurious_dimer

custom = (CheckRegistry()
    .add(stability_in_range('H1', min_dg=-10, max_dg=-5))
    .add(no_spurious_dimer('H1', 'CP', min_ddg=-4.0))
)
report = cha.verify(registry=custom)

Built-in checks: toehold_accessible, stability_in_range, reaction_driving_force, no_spurious_dimer, leakage_below_signal, and custom(name, fn) for arbitrary user predicates.

Exporting to mantis

Every template has the same downstream methods:

rn = cha.to_crnetwork()                # → mantis.CRNetwork
sim = cha.simulate(initial_conditions, (0, 7200))
ss  = cha.steady_states(initial_conditions)

Defining your own circuit

Subclass CircuitTemplate to add a new topology — declare reactions and a default check registry, get the full pipeline for free:

from dataclasses import dataclass
from strider import CircuitTemplate, CheckRegistry, reaction_driving_force

@dataclass
class MyAmplifier(CircuitTemplate):
    def __post_init__(self):
        if self.name == 'circuit':
            self.name = 'MyAmplifier'
        self.reactions = ['A + B <-> AB', 'AB + C -> AC + B']
        self.toehold_map = {'A + B <-> AB': 6}

    def _default_checks(self):
        return (CheckRegistry()
            .add(reaction_driving_force(['A', 'B'], [['A', 'B']], max_ddg=-3.0)))

Generic CircuitBridge

For ad-hoc circuits without a dedicated template, CircuitBridge accepts any list of reaction strings:

from strider import CircuitBridge

bridge = CircuitBridge(
    reactions=['A + B <-> AB', 'AB + C <-> ABC'],
    sequences={'A': '...', 'B': '...', 'C': '...'},
    include_leakage=True,
    leakage_threshold=-4.0,
)
rn = bridge.to_crnetwork()

Compatibility note: CHABridge from the prior API is still available and unchanged, but new code should prefer strider.circuits.CHA, which uses the generic check registry and composes with other templates.


12. DSDCompiler — domain-level circuit assembly

DSDCompiler lets you describe a circuit in domain space — registered domains plus strands defined as ordered domain lists — and resolves to nucleotide sequences automatically, including reverse-complement (a*) generation.

from strider import DSDCompiler

dsd = DSDCompiler(domains={
    't': 'GCATGC',            # toehold
    'a': 'ATGCATATGC',         # branch migration region
    'b': 'TTGCATGCAA',         # extension
})
dsd.add_strand('S1', ['t', 'a', 'b'])
dsd.add_strand('S2', ['b*', 'a*', 't*'])         # auto-derived complements
dsd.add_reaction('S1 + S2 <-> S1_S2', toehold='t')

print(dsd)                                        # pretty-printed circuit
bridge = dsd.to_bridge()                          # CircuitBridge
rn = bridge.to_crnetwork()

The compiler intentionally does not infer reactions from strand topology — you still write them explicitly. The job is to keep the symbolic layer (domains, strands) in sync with the sequence layer.

Deriving the reactions automatically — DomainReactionEnumerator

When you don't want to write the reactions by hand, DomainReactionEnumerator does the Visual DSD / Peppercorn job: it reads the strand topology and enumerates the reachable complexes plus the transitions between them — bind (a complementary toehold pair, one per complex, hybridises and merges), 3-way branch migration (an unbound domain adjacent to a junction displaces an identical incumbent), and open (a toehold-length helix dissociates). Forward rates come from the Zhang–Winfree model; reverse rates from detailed balance against the helix ΔG computed by the active ThermoEngine (so Keq = kf/kr = exp(−ΔG/RT)). The result drops straight into a mantis.CRNetwork.

from strider import ThermoEngine, DomainReactionEnumerator

enum = DomainReactionEnumerator(
    domains={'t': 'CCCT', 'b': 'ACGTACGTACGT'},   # t = 4-nt toehold, b = branch
    engine=ThermoEngine(material='dna'),
)
result = enum.enumerate(
    strands={'Invader': ['t', 'b'], 'Output': ['b'], 'Base': ['b*', 't*']},
    initial_complexes=[['Output', 'Base']],        # substrate starts hybridised
)
print(result.summary())          # derived complexes + reactions + rates
crn = result.to_crnetwork()      # → mantis.CRNetwork, ready to simulate

This enumerates the canonical TMSD network — Invader binds the Output·Base substrate via the toehold, branch-migrates along b, and releases Output — with no hand-written reactions. Scope (v1): non-pseudoknotted, 3-way only; 4-way migration and intramolecular hairpin re-closure are not modelled, and max_complexes/max_strands caps guarantee termination on polymerising motifs. See examples/10_domain_enumeration.py.


13. Stochastic simulation via mantis

For low-copy-number regimes where deterministic ODE breaks down (e.g. single-cell concentrations, stochastic switching in bistable circuits), mantis provides a Gillespie SSA direct-method simulator:

rn = cha.to_crnetwork()

# 100 µL = 1e-4 L  →  10 nM mirna ≈ 600 molecules
result = rn.stochastic_simulate(
    initial_conditions={'mirna': 10e-9, 'H1': 100e-9, 'H2': 100e-9, 'CP': 100e-9},
    t_span=(0.0, 60.0),
    volume_L=1e-4,
    seed=0,
)
print(result.n_events, result.success)
print(result.final())               # {'mirna': ..., 'H1': ..., ...}
print(result.counts['H1_H2'][-1])   # integer molecule count

StochasticResult carries both .counts (integer arrays) and .concentrations (M). For cellular volumes use volume_L ≈ 1e-15 and initial_as='count' to specify molecule counts directly. The deterministic simulate() and the stochastic stochastic_simulate() should agree in the high-count limit; for < ~10³ molecules they typically diverge.


14. Parameter sweeps and caching

ParameterSweep runs any callable over an N-dimensional grid with transparent caching and optional parallelism.

from strider import ThermoEngine, ParameterSweep, DiskCache

engine = ThermoEngine()
cache = DiskCache('/tmp/sweep_cache.db')
sweep = ParameterSweep(engine, cache=cache, n_workers=4)

# Built-in: toehold length sweep
result = sweep.toehold_sweep(
    hairpin_seq='TCAACATCAGTCTGATAAGG',
    toehold_lengths=list(range(2, 12)),
    target_strand='TAGCTTATCAGACTGATGTTGA',
)
result.plot(xlabel='Toehold length (nt)', ylabel='kf (M⁻¹ s⁻¹)')

# Built-in: temperature sweep
result = sweep.temperature_sweep(
    sequences={'H1': 'ATCG...', 'H2': 'CGAT...'},
    temperatures=list(range(20, 65, 5)),
)

# Custom N-D grid sweep
def my_score(params: dict) -> float:
    engine2 = ThermoEngine(celsius=params['temperature'])
    return engine2.pfunc('ATCG').free_energy

result = sweep.grid_sweep(
    axes={'temperature': [25, 37, 50], 'sodium': [0.05, 0.137, 0.5]},
    fn=my_score,
)
print(result.optimum())            # {'temperature': 25, 'sodium': 0.05}
result.plot()

# Convert to pandas DataFrame for further analysis
df = result.to_dataframe()         # requires pandas extra

DiskCache details

The cache uses SQLite3 in WAL mode for safe concurrent reads/writes across parallel workers. LRU eviction is triggered when the database exceeds max_size_mb.

cache = DiskCache(
    path='~/.strider/cache.db',
    max_size_mb=500,    # evict oldest 20% when exceeded
    ttl_days=30,        # entries expire after 30 days
)
with cache:             # context manager closes the connection
    val = cache.get('my_key')
    cache.set('my_key', result_object)
    print(cache.stats())

15. Parameter sets and custom NN tables

Nearest-neighbor energies live in a swappable ParameterSet object. The built-in "native" set is assembled from published constants — SantaLucia 2004 (DNA) and Mathews 1999 / Turner 2004 (RNA) — and is always available. Additional Turner-schema JSON files dropped into $STRIDER_PARAMS_DIR or into strider/thermo/parameters/ are auto-discovered by basename. Custom sets actually change the numerical output of pfunc / mfe / sample — the override is threaded through the energy DP, not just stamped on the cache key.

from strider import ParameterSet, load_parameters, list_parameter_sets, ThermoEngine

# What's available in this environment?
print(list_parameter_sets())          # ['native', 'dna-low-salt-50mM-Na']
                                      # (or more if user has supplied JSON via STRIDER_PARAMS_DIR)

# Inspect the native set
p = load_parameters('native')         # = 'native-dna'; use 'native-rna' for RNA
print(p)                              # ParameterSet(name='native-dna', material='DNA', wobble=False, keys=22)
print(p.dG['stack']['AATT'])          # -1.0  (SantaLucia 2004)
print(p.multiloop_params())           # (a, b, c) = Turner-style linear ML coefficients

# Use a specific parameter set with the engine — custom sets DO change numerics.
engine_default  = ThermoEngine(material='dna')                                # native, fast path
engine_lowsalt  = ThermoEngine(material='dna', parameter_set='dna-low-salt-50mM-Na')
seq = 'GCGCAAAAGCGC'
print(engine_default.pfunc(seq).free_energy)   # -3.13 kcal/mol
print(engine_lowsalt.pfunc(seq).free_energy)   # -2.82 kcal/mol  (destabilised by salt shift)

Exporting + editing a parameter set

# Export the native baseline as editable JSON
python scripts/export_paramset.py --name native-dna --rebuild-native --out my-dna.json
# Edit my-dna.json in place, then drop it where the loader will find it:
mv my-dna.json strider/thermo/parameters/   # OR set $STRIDER_PARAMS_DIR

The exporter writes every sub-table, so the result is a complete self-contained set; partial JSONs (just a couple of perturbed entries) are also valid — sub-tables not present in the JSON fall back to the module-level defaults via the per-call override channel.

JSON file format (<name>.json):

{
    "name": "my-custom-dna",
    "material": "DNA",
    "default_wobble_pairing": false,
    "dG": {
        "stack":            {"AATT": -1.00, "CGCG": -2.17, "...": "..."},
        "hairpin_size":     [99, 99, 99, 4.1, 4.3, "..."],
        "bulge_size":       ["..."],
        "interior_size":    ["..."],
        "asymmetry_ninio":  [0.4, 0.3, 0.2, 0.1, 3.0],
        "terminal_penalty": {"AT": 0.45, "TA": 0.45},
        "multiloop_init":   3.4, "multiloop_pair": 0.4, "multiloop_base": 0.0,
        "dangle_5":         {"AAT": -0.5, "...": "..."},
        "dangle_3":         {"...": "..."},
        "terminal_mismatch":{"...": "..."},
        "hairpin_mismatch": {"...": "..."},
        "interior_mismatch":{"...": "..."},
        "interior_1_1":     {"...": "..."},
        "interior_1_2":     {"...": "..."},
        "interior_2_2":     {"...": "..."},
        "hairpin_triloop":  {"...": "..."},
        "hairpin_tetraloop":{"...": "..."},
        "coaxial_stack":    {"...": "..."}
    },
    "dH": {"stack": {"AATT": -7.9, "...": "..."}}
}

Schema reference (Turner / Mathews convention) — all 22 sub-tables consumed by the energy DP:

Sub-table Threaded into DP? What it controls
stack 16 (DNA) / 16 (RNA) WC stacks; can also carry mismatch stacks
hairpin_size, bulge_size, interior_size Length-indexed loop-initiation tables
asymmetry_ninio, log_loop_penalty Loop asymmetry + log-extrapolation
terminal_penalty AU/GU/AT helix-end penalty
multiloop_init/pair/base Linear multiloop coefficients
join_penalty (cache key only) Per-nick correction
dangle_3, dangle_5 Dangling-end ΔG
terminal_mismatch Mismatch at helix end / RNA hairpin first-mismatch
hairpin_mismatch ✅ (DNA) First-mismatch contribution at DNA hairpin loops
interior_mismatch ✅ (DNA) Mismatch at interior loop closing pair
interior_1_1, interior_1_2, interior_2_2 ✅ (DNA) Sequence-specific small interior loops
hairpin_triloop, hairpin_tetraloop Sequence-specific 3-/4-nt hairpin loop bonuses
coaxial_stack ✅ (DNA) Walter et al. 1994 coaxial stacking

Note on the override gating. Passing parameter_set=None (the default), "native", "native-dna", or "native-rna" keeps the DP on its fast path — no per-call override is installed, and numerical output is bit-identical to every prior release. Only explicit non-native names or ParameterSet instances activate the override channel.


16. Differentiable thermodynamics (PyTorch)

Requires PyTorch — everything in this section needs the optional diff extra: pip install 'strider-dna[diff]'. The rest of strider works without it.

strider.thermo.differentiable provides a fully batched PyTorch McCaskill-style partition-function DP whose nearest-neighbor parameters are nn.Parameters — so the same ensemble ΔG that ThermoEngine.pfunc(...) computes can be back-propagated through, optimized, and trained against experimental data. It doubles as a fast batched / GPU backend: the whole batch folds in one vectorised DP, so it runs ~9–12× faster than the pure-Python native engine on batched workloads (and scales further on a GPU), closing most of native's speed gap to a C kernel — while remaining learnable, which a closed kernel can never be.

import torch
from strider.thermo.differentiable import (
    ThermoParameters, BatchedPartitionFunction, batched_free_energy,
)

# One-shot batched ensemble ΔG (inference). device='cuda' for the GPU path.
energies = batched_free_energy(["GGGCUUCGGCCC", "AUGCAUGC", "GCGCGC"], material="rna")

# Or drive the model directly to train against measured ΔG values:
params = ThermoParameters(material="rna")              # all NN tables exposed as nn.Parameter
model  = BatchedPartitionFunction(params)
pred   = model(["GGGCUUCGGCCC", "AUGCAUGC", "GCGCGC"])    # tensor shape (B,)
target = torch.tensor([-5.20, -0.005, -2.10], dtype=torch.float64)
loss   = torch.nn.functional.mse_loss(pred, target)
loss.backward()                                            # gradients flow into every NN table

The PyTorch engine implements the same Mathews-Turner conventions as the native McCaskill engine in thermo/ensemble.py, and now uses the full 36-entry nearest-neighbor stack table (all six pair types incl. GU/UG wobble, keyed by all four bases of the step) plus the single-base-bulge stack-across term — closing the multi-kcal residual that the old 16-entry Watson-Crick dinucleotide table produced on wobble-containing helices. The two engines now agree to 0.3 kcal/mol mean (≤1.0 max) on random sequences of both materials. Reproduce with python scratch/compare_engines.py.

Family mean |res| (diff vs native, RNA, 37 °C) status
10-nt random RNA 0.03 kcal/mol aligned
Triloop hairpins 0.005–0.05 kcal/mol aligned
Tetraloop hairpins 0.15–0.30 kcal/mol aligned (within dangle precision)
Y-shape multiloops (32 nt) 0.20 kcal/mol aligned
30-nt random RNA (incl. GU wobble) 0.28 kcal/mol (max ~1.0) aligned (full stack table)
30-nt random DNA 0.25 kcal/mol (max ~0.8) aligned

Physical conventions wired identically across both engines:

  • U/T normalization at every lookup site. RNA sequences are folded in T-form internally so that TERMINAL_PENALTY, TERMINAL_MISMATCH, DANGLE_3 / DANGLE_5, INTERIOR_MISMATCH, and STACK (all stored with T-keys in parameters_rna.py) hit correctly; only HAIRPIN_TRILOOP / HAIRPIN_TETRALOOP are looked up in U-form.
  • Triloop terminal-mismatch convention. The first-mismatch term at the closing pair applies only for loop_size >= 4; triloops carry only the special-loop bonus + terminal-pair penalty.
  • External-loop dangle decoration. Four-state per stem (BARE / D5 / D3 / D5+D3) with each dangle decoration sign-gated (only added when its ΔG < 0). The D5 cases use the left context W[i, k−2] so the dangle base at k−1 is not double-counted as unpaired.
  • Multiloop initiation. The outer closing pair charges ML_INIT + ML_PAIR; each inner stem charges ML_PAIR via the M / M1 recurrences, matching bm_ml_init_pair = boltz(ML_INIT + ML_PAIR) in ensemble.py.
  • Interior-loop / bulge universal correction. Single-base bulges add the nearest-neighbor stack-across-the-bulge term plus +TP_outer − TP_inner; multi-base bulges and RNA general interior loops add +2·TP_outer; DNA interior loops add +TP_outer − TP_inner (the INTERIOR_MISMATCH-at-junctions DNA refinement is tracked as a follow-up).

Training entry point is strider/thermo/train.py. The intended workflow is BatchedPartitionFunction(ThermoParameters(material=...)) → torch optimizer over the parameter groups (physical tables on an aggressive LR, neural-residual MLPs on a conservative LR — see tests/test_differentiable.py::test_toy_training_step for the pattern).

Gradient-based sequence design

The differentiable engine is also differentiable in the sequence, which turns inverse design into gradient descent. The keystone is that the base-pair-probability matrix is the gradient of the free energy with respect to a per-pair energy bias — ∂F/∂ε_ij = P(i, j) — so a single backward pass over a zero-valued bias field yields the whole McCaskill BPP matrix, differentiable a second time w.r.t. a soft sequence (a (B, N, 4) distribution over A/C/G/U). Every structure-level design objective is built on it.

from strider.thermo.differentiable import pair_probabilities, soft_pair_probabilities
from strider.thermo.diff_design import DiffObjective
from strider.design.diff_designer import DifferentiableDesigner
from strider.design.optimizer import DomainSpec
from strider.design.objective import DesignObjective
from strider import ThermoEngine

# BPP by autodiff (matches ThermoEngine.pairs(); differentiable for soft seqs).
bpp = pair_probabilities(["GGGCAGCCUUCGGCUGCCC"], material="rna")   # (1, N, N)

# Compose a differentiable objective: hit a target structure, band GC, avoid runs.
target = "(((((((....)))))))"
objective = (DiffObjective.ensemble_defect(target)
             + 0.2 * DiffObjective.gc_band(0.4, 0.6)
             + 0.1 * DiffObjective.forbidden_motifs(["GGGG", "CCCC"]))

# Gradient descent on simplex logits, then a short SA polish (hybrid hand-off).
eng = ThermoEngine(material="rna", celsius=37.0)
designer = DifferentiableDesigner(material="rna", engine=eng, seed=0)
result = designer.design(
    {"hp": DomainSpec(length=len(target), material="rna")},
    objective,
    sa_objective=DesignObjective.ensemble_defect(eng, "hp", target),  # discrete polish
)
seq = result.sequences["hp"]              # e.g. CCACGUCAAUUGACGUGG; native MFE == target

DiffObjective is composed exactly like DesignObjective (weighted sum, +/*, evaluate_breakdown), with factories for ensemble defect, ΔG / ΔΔG targets (free_energy_target / free_energy_range), GC content / band, toehold accessibility, pairing entropy, and forbidden motifs. DifferentiableDesigner optimizes per-position base logits with Adam under a temperature schedule (free positions move, DomainSpec(sequence=…) domains are clamped), rounds to a discrete sequence, then hands off to the existing simulated-annealing SequenceDesigner — warm-started via its new initial_sequences= argument — for a short discrete polish, returning the same DesignResult.

Multi-strand complexes. The nick-aware DP (forward/soft_forward with nicks=, plus complex_free_energy / complex_pair_probabilities) folds a concatenation of strands: cross-strand pairs may close at any separation, hairpins may not span a nick, and the homomeric rotational-symmetry correction +RT·ln σ is applied so the complex ΔG matches ThermoEngine.pfunc(*strands). Pass nicks= to DifferentiableDesigner.design to co-design a duplex or toehold complex against its ensemble_defect. The differentiable BPP / defect agree with the native engine to the same ~0.3 kcal residual as the free energy (amplified into a ratio only on register-degenerate homopolymer stems); multi-strand ΔG agrees to ~0.5 kcal mean. See examples/11_gradient_design.py and tests/test_diff_design.py. The full multistate test-tube equilibrium-concentration design (differentiating through the concentration solve) is a tracked follow-up; single-complex defect design is supported today.


17. Export formats

from strider import to_vienna, to_ct, to_bpseq, to_fasta, to_oxdna, write

seq = 'GGGAAATTTCCC'
struct = '(((.....)))'

# Individual format functions
print(to_vienna(seq, struct, name='hairpin'))
print(to_ct(seq, struct, name='hairpin', energy=-2.8))
print(to_bpseq(seq, struct))
print(to_fasta(seq, name='hairpin', description='miR-21 probe'))
print(to_oxdna(seq))      # topology skeleton for MD simulations

# Write to file (auto-detect format from extension)
write(seq, struct, path='output.rna', fmt='vienna')   # fmt: vienna|ct|bpseq|fasta|oxdna
write(seq, struct, path='output.ct',  fmt='ct', energy=-2.8)

18. Surface transducer, LOD, and surface ΔG

NUPACK assumes a well-mixed 3-D bulk and stops at static equilibrium. But almost every clinical readout — electrochemical, SPR, gold-nanoparticle — happens at a tethered surface, where capture is diffusion-limited, the probe layer has finite capacity, and the local salt/entropy environment warps hybridization. strider.surface adds that layer. It turns a solution-phase concentration trace C(t) (typically a mantis SimulationResult species) into a predicted signal and a limit of detection.

from strider import SurfaceModel, SurfaceParams, PrussianBlueLabel, ReadoutChain
import numpy as np

params = SurfaceParams(
    d_species_m2_s=1e-10,        # analyte diffusion coefficient
    electrode_radius_m=1.5e-3,   # 3 mm⌀ working electrode
    incubation_s=90 * 60,
    sample_volume_L=50e-6,
    probe_density_per_m2=1e16,   # capture sites → finite capacity (ULOQ)
    label=PrussianBlueLabel(diameter_nm=40.0),   # charge per captured event
    readout=ReadoutChain(),      # LMP91000 TIA + ESP32-S3 ADC → noise floor
)
model = SurfaceModel(params)

times = np.linspace(0, 90 * 60, 400)
dimer_M = ...                    # e.g. sim.concentrations['H1_H2']
res = model.transduce(times, dimer_M)
print(res.capture_fraction, res.peak_current_A, res.detectable)

# straight from a mantis result:
res = model.transduce_result(sim, species='H1_H2')

Capture uses the Shoup–Szabo absorbing-disk flux (spans the Cottrell transient → steady state) with a finite-capacity cap N = N_max·(1 − e^(−N_unsat/N_max)) that sets the upper limit of the working range. Read-out maps each captured event onto a charge via a pluggable LabelModel; the bundled PrussianBlueLabel models a redox nanoparticle whose addressable fraction is set by counterion (K⁺) shell-penetration per DPV pulse. Any reporter chemistry plugs in by implementing signal_per_event().

LOD is the lowest trigger whose signal clears the read-out floor:

ref = dimer_M                                  # reference trace at one trigger
make_trace = lambda c: (times, ref * (c / 1e-15))   # linear-cascade scaling
lod = model.lod(make_trace, triggers=np.logspace(-18, -12, 31))

Surface ΔG corrections capture the thermodynamic warping a tether imposes, reusing strider.thermo.salt:

from strider import SurfaceCorrection, ThermoEngine

sc = SurfaceCorrection(bulk_na_M=0.137, probe_density_per_m2=1e16,
                       spacer='c6', n_segments=6)
# per-strand salt offset (Gouy–Chapman local salt) plugs into the engine hook:
engine = ThermoEngine(material='dna', correction_model=sc)
sc.tether_offset()       # complex-level configurational-entropy penalty (kcal/mol)

A dense, charged probe monolayer accumulates counterions (double_layer_local_salt → Gouy–Chapman ψ₀ → Boltzmann-enhanced local [Na⁺]), which stabilizes duplexes; pinning one strand-end costs configurational entropy (tether_dg, a spacer table + optional ideal-chain term), which destabilizes. The salt part is genuinely per-strand and rides the existing ThermoEngine(correction_model=…) hook; the tether part is complex-level and added explicitly to a capture ΔΔG.

19. G-quadruplex / aptamer folding

A G-quadruplex (G4) is something a Watson–Crick partition function structurally cannot represent: four guanine tracts fold into stacked Hoogsteen tetrads around a central column of monovalent cations (K⁺ ≫ Na⁺). NUPACK hardcodes pseudoknots off and models only WC/wobble pairs, so it has no way to express a G4 at all. strider adds it as a competing macrostate on top of the McCaskill ensemble, with the K⁺/Na⁺ dependence that turns a G4 aptamer into a sensor.

from strider import fold_quadruplex, quadruplex_ensemble, find_g4_motifs

# Putative-quadruplex-sequence (PQS) recognition — pure sequence pattern
find_g4_motifs("AGGGTTAGGGTTAGGGTTAGGG")    # → [G4Motif(n_tetrads=3, loops=[3,3,3], ...)]

# Two-state thermodynamics with cation dependence
f = fold_quadruplex("AGGGTTAGGGTTAGGGTTAGGG", celsius=37, potassium=0.1, sodium=0.0)
f.dG, f.tm_celsius, f.folded_fraction      # ≈ -2.5 kcal/mol, 57 °C, 0.98 (telomeric G4)

# Duplex/hairpin-vs-G4 equilibrium competition (reuses the rigorous DP)
e = quadruplex_ensemble("AGGGTTAGGGTTAGGGTTAGGG", potassium=0.1)
e.p_g4, e.p_secondary                       # population in G4 vs WC structures, sums to 1

The G4 is folded into the partition function as Z_total = Z_secondary + Σ_g exp(−ΔG_g/RT)·Z_flank(g), where Z_flank(g) is computed by forcing the tetrad guanines unpaired via the existing blocked constraint — so the duplex-vs-G4 competition is exact within the model and needs no edit to the core DP. The two-state ΔH/ΔS model has a tract-association nucleation term, a per-tetrad-stack term (more tetrads ⇒ more stable), a loop-length entropic penalty (Guédin, Gros & Mergny 2010), and a Langmuir cation term sized so a G4 is essentially unfolded without stabilizing cation and K⁺ ≫ Na⁺. Reference parameters are fit to canonical melts (c-myc Pu22, telomere 22AG, thrombin-binding aptamer; see scratch/fit_g4_params.py). The absolute numbers carry the field's real construct-to-construct spread, but the trends — 3-tetrad > 2-tetrad, short loops > long loops, K⁺ > Na⁺, [cation]↑ ⇒ stabilize — are guaranteed correct. Pairs naturally with §18: a K⁺-gated G4 aptamer's folded fraction drives the surface read-out (see examples/11_quadruplex_aptamer.py).

20. Low-copy stochastic capture — shot-noise-limited LOD

The deterministic SurfaceModel (§18) integrates a diffusion-limited flux against a bulk concentration that never depletes — fine at high analyte, a fantasy at the fM–aM concentrations where a limit of detection actually lives, where the sample aliquot holds only ~10¹–10⁴ molecules. There, capture is a counting process and its Poisson shot noise — not the amplifier — sets the LOD. StochasticSurfaceModel adds that physics.

from strider.surface import StochasticSurfaceModel, SurfaceParams

sto = StochasticSurfaceModel(SurfaceParams())
lv = sto.levels()                  # Currie thresholds, in captured-molecule counts
lv.critical_level, lv.detection_limit   # L_C = k·σ₀,  L_D = 2·L_C + k² = 3.29·σ₀ + 2.71

make = lambda c: (times, np.full_like(times, c))     # a C(t) trace per trigger
sto.shot_noise_lod(make, triggers)   # lowest trigger reaching L_D (counting-limited)
sto.detection_probability(*make(1e-16))              # power curve incl. shot noise

# drive the capture as a mantis Gillespie SSA (single-molecule resolution)
samp = sto.simulate_capture(*make(5e-17), n_trajectories=200)
samp.empirical_mean, samp.empirical_var              # ≈ μ, μ  (Poisson)

The captured mean is capped at the molecule budget (μ = N_total·(1 − exp(−N_unsat/N_total))) and the realized count is Poisson(μ). The Currie (1968) detection framework gives L_D = 3.29·σ₀ + 2.71 counts with σ₀ = √(μ_b + σ_read²) (blank + read-out noise as equivalent label events); the irreducible +k² term is the textbook ≈2.71-captured-molecule zero-background floor — no electronics can beat it. The resulting shot_noise_lod is ~10³× higher (and more honest) than the deterministic SurfaceModel.lod, which on the reference biosensor "detects" 3 molecules. simulate_capture builds a one-reaction capture CRN and runs the mantis SSA to reproduce the Poisson statistics end to end. See examples/12_shot_noise_lod.py. (Residual: a full reaction-diffusion PDE — spatial gradients near the electrode — is out of scope; this is the well-mixed shot-noise budget.)


API reference

ThermoEngine

ThermoEngine(
    material='dna',         # 'dna' | 'rna'
    celsius=37.0,
    sodium=0.137,           # [Na+] in molar
    magnesium=0.01,         # [Mg2+] in molar
    backend='auto',         # 'auto' | 'native' | 'vienna'
    cache=None,             # DiskCache | None
    correction_model=None,  # callable(seq) → float | None
    parameter_set=None,     # str | ParameterSet | None
)  ThermoEngine

Methods

Method Returns Description
mfe(*sequences) MFEResult Minimum free energy structure
pfunc(*sequences) PFuncResult Ensemble free energy and pair probability matrix (σ-corrected for homomeric multi-strand)
pairs(*sequences) np.ndarray Pair-probability matrix only
ensemble_defect(seqs, target_structure, normalize=True) float Expected mispaired nucleotides vs a target dot-bracket
sample(seq, n_samples, seed=None) list[(str, list)] Boltzmann-sampled structures
subopt(seq, gap=1.0, max_structures=200) list[(str, float, list)] Suboptimal structures within gap of MFE
duplex_dg(seq1, seq2=None) float ΔG of hybridization; seq2=None → intramolecular folding
ddg(reactants, products) float ΔΔG = Σ G(products) − Σ G(reactants) (kcal/mol)
toehold_accessibility(seq, positions) float Fraction of ensemble with all toehold positions unpaired
melting_temperature(seq, strand_conc_M) float Melting temperature (°C)
mfe_batch(strand_groups, n_workers) list[MFEResult] Parallelized batch MFE
available_backends() (classmethod) list[str] Backends importable in this environment

MFEResult

@dataclass
class MFEResult:
    energy:     float                  # kcal/mol (negative = stable)
    structure:  str                    # dot-bracket string
    base_pairs: list[tuple[int, int]]  # (i, j) pairs, 0-based
    sequence:   str                    # input sequence

PFuncResult

@dataclass
class PFuncResult:
    free_energy:       float       # ensemble ΔG = -RT ln Q (kcal/mol)
    partition_function: float      # dimensionless Q
    pair_probs:        np.ndarray  # shape (n, n) base-pair probability matrix

Circuit templates

All templates subclass CircuitTemplate and share the same downstream surface.

Class Required keys Key parameters
CHA(sequences, ...) mirna, H1, H2, CP toehold_d1=6, toehold_d2=11, tail_cp=9
HCR(sequences, ...) I, H1, H2 toehold_initiator=6, toehold_branch=6
Translator(sequences, ...) X, Y, Gate toehold_x=6
SeesawGate(sequences, ...) Input1, [Input2,] Gate, Threshold[_InputN], Fuel, Output logic='YES'|'AND'|'OR'|'NOT', toehold=6

Shared methods:

Method Returns Description
to_bridge(include_leakage=False, leakage_threshold=-4.0) CircuitBridge Build the generic mantis bridge
to_crnetwork(**kw) mantis.CRNetwork Shortcut: bridge → network
simulate(ic, t_span, **kw) SimulationResult Deterministic ODE
steady_states(ic, **kw) list[SteadyState] mantis steady-state finder
verify(registry=None) CircuitReport Run default (or user) check suite

CHA additionally provides two classmethods that generate sequences from a target: CHA.from_target(target, *, d1_len, d2_len, loop, capture='') and CHA.design(target, *, d1_grid, d2_grid, capture_len, rerank_top_n=3, n_trials, max_iterations, …).

Surface transducer (strider.surface)

Class / function Description
SurfaceModel(params) .transduce(times, C_M), .transduce_result(sim, species), .lod(make_trace, triggers), .max_capture_sites()
SurfaceParams(...) geometry, incubation, probe_density_per_m2, label, readout
LabelModel / PrussianBlueLabel reporter → charge per captured event (signal_per_event()); subclass LabelModel for other chemistries
ReadoutChain(...) TIA gain + ADC + averaging → current_floor_A(), charge_floor_C()
SurfaceCorrection(...) callable (seq)->float salt offset for ThermoEngine(correction_model=…); .tether_offset() complex-level penalty
tether_dg, double_layer_local_salt, debye_length_m standalone surface-ΔG primitives
StochasticSurfaceModel(params, blank_mean_counts=0, k=1.645) .levels() (Currie L_C/L_D), .capture_mean, .detection_probability, .shot_noise_lod(make_trace, triggers), .simulate_capture(...) (mantis SSA)
currie_levels(blank_mean, sigma_read, k) / detection_probability(mean_signal, levels) Currie (1968) counting thresholds and detection power curve
readout_sigma_counts(params) read-out floor in equivalent captured-label counts

G-quadruplex (strider.structure.quadruplex)

Function / class Description
find_g4_motifs(seq, min_tetrads=2, max_tetrads=4, min_loop=1, max_loop=7) PQS pattern recognition → list[G4Motif] (most stable first)
g4_thermodynamics(motif, celsius, potassium, sodium) two-state (ΔH, ΔS, ΔG) of folding into a motif
fold_quadruplex(seq, celsius, potassium, sodium, …) best G4 → G4Fold(motif, dG, tm_celsius, folded_fraction, structure)
quadruplex_ensemble(seq, celsius, material, sodium, magnesium, potassium, …) duplex/hairpin-vs-G4 partition competition → QuadruplexEnsemble(p_g4, p_secondary, …)

Design helpers

Function Description
DesignObjective.reaction_driving_force(engine, reactants, products, max_ddg, assemble_fn=None, weight=1.0) one-sided coupling-constraint penalty on an assembled reaction's driving force
design_with_rerank(designer, contexts, build_problem, score_fn, top_n=3, **design_kw) design top-N pre-ranked contexts, pick by downstream score_fnRerankResult

CircuitBridge and CHABridge

CircuitBridge(reactions, sequences, engine=None, toehold_map=None, include_leakage=False, leakage_threshold=-4.0) — generic, accepts any reaction topology. Returned by every template's to_bridge().

CHABridge(sequences, ...) is retained for backwards compatibility — same parameters and API as in the original 0.1.0 release. New code should prefer circuits.CHA.

CheckRegistry

CheckRegistry().add(check).add(check)... → use .run(engine, sequences, name=...) to produce a CircuitReport.

Built-in check Signature
toehold_accessible(strand, positions, min_prob=0.5) Strand's toehold positions are unpaired ≥ min_prob of the ensemble
stability_in_range(strand, min_dg, max_dg, reference_length=20) Normalized hairpin ΔG falls in the sweet spot
reaction_driving_force(reactants, products, max_ddg=-3.0) ΔΔG of the reaction is sufficiently favorable
no_spurious_dimer(a, b, min_ddg=-6.0) Pairwise dimer is NOT too stable
leakage_below_signal(signal_kf, hairpin, ratio=1e-4) Spontaneous breathing rate is ≥ ratio× slower than signal
custom(name, fn) Wrap any (ctx) → (passed, value, msg) function

solve_equilibrium

solve_equilibrium(
    complexes,                # {name: ([strand_names], dG_kcal_per_mol)}
    totals,                   # {strand_name: total_concentration_M}
    celsius=37.0,
    max_iter=200,
    tol=1e-9,
    standard_state_M=1.0,     # pass water_molarity(celsius) if ΔG is at the ~55 M ref
)  EquilibriumResult

Companions: equilibrium_from_engine(engine, strands, totals, max_size=2) for auto-enumeration (now a thin wrapper over Tube.analyze), cyclic_symmetry(strand_list) and water_molarity(celsius) helpers.

Strand / Complex / SetSpec / ComplexSet / Tube / TubeResult

Strand(name: str, sequence: str, material: str = "dna")                 # frozen, hashable
Complex(strands: tuple[Strand|str, ...], name: str | None = None)       # resolved or name-only
Complex.from_names(strand_names: list[str], name: str | None = None)    # name-only constructor

SetSpec(max_size: int = 1,
        include: list[Complex] = [],
        exclude: list[Complex] = [])

ComplexSet(strands: Iterable[Strand], spec: SetSpec | None = None)
# Methods: .enumerate() → list[Complex], iterator protocol, len()

Tube(strand_totals: dict[Strand, float],
     complexes: ComplexSet,
     name: str = "tube")
# Methods: .analyze(engine, tol=1e-9) → TubeResult

TubeResult                                  # dataclass
# Fields: tube_name, concentrations, free_energies, strand_free,
#         complexes, converged, iterations, residual
# Methods: .pair_probabilities(complex_name) → np.ndarray
#          .defect(complex_name, target_structure) → float

tube_analysis(tubes: Iterable[Tube], engine, tol=1e-9)  dict[str, TubeResult]

Complex is hashed and compared by the canonical (sorted) strand-name tuple, so cyclic rotations of the same complex are identified. Complex.sigma returns σ (Dirks 2007). A Complex may be resolved (strands are Strand objects with sequences) or name-only (strands are bare strings used at design-spec time before sequences are known); call .is_resolved to check, .resolve(strand_dict) to upgrade.

Assay / AssayPanel / Assembly

# Original signature (still works — internally wraps a name-only Complex):
Assembly(name, strands, structure=None, concentration=1e-6)

# Or build explicitly from a Complex:
Assembly.from_complex(complex, structure=None, concentration=1e-6)

Assay(name, on_targets=[Assembly, ...], off_targets=[Assembly, ...],
      off_target_ddg_threshold=-4.0, off_target_penalty_weight=1.0)
AssayPanel(assays=[Assay, ...])

Methods: defect(sequences, engine) → float, to_objective(engine, weight=1.0, equilibrium=False) → DesignObjective. Passing equilibrium=True weights each on-target by its true Tube.analyze post-equilibrium concentration instead of the declared Assembly.concentration (one Newton solve per objective evaluation).

Assembly now composes a Complex under the hood — .complex, .strand_names, .name (canonical) are exposed alongside the original .strands, .structure, .concentration fields.

ParameterSet / load_parameters

ParameterSet(name, material, default_wobble_pairing,
             dG: dict, dH: dict,
             source_path: str | None = None,
             comment: str = "")

load_parameters(name: str = "native")  ParameterSet
list_parameter_sets()  list[str]
param_search_paths()  list[pathlib.Path]

Built-in sets: "native" (= "native-dna"), "native-rna". Additional Turner-schema JSON files placed in $STRIDER_PARAMS_DIR or in the package's parameters/ directory are auto-discovered by name. ParameterSet accessors: .stack(top5, top3, bot5, bot3), .hairpin_loop(n), .bulge_loop(n), .interior_loop(n), .terminal_penalty(b5, b3), .multiloop_params() → (a, b, c), .keys(), .has(key).

DSDCompiler

DSDCompiler(domains={name: sequence}).add_strand(name, [domain, ...])
                                     .add_reaction(rxn_str, toehold=...)
                                     .to_bridge()  CircuitBridge

SequenceDesigner

designer = SequenceDesigner(engine=None, seed=None)

result = designer.design(
    domains,                       # dict[str, DomainSpec]
    objective,                     # DesignObjective
    hard_constraints=[],
    n_trials=10,
    max_iterations=500,
    T_start=1.0,                   # initial simulated annealing temperature
    T_end=0.01,                    # final temperature
    verbose=False,
    mutation_policy=None,          # MutationPolicy | None — defaults to Random
    parallel_tempering=False,      # geometric T_end → T_start ladder of chains
    n_chains=4,
    swap_every=20,
)  DesignResult

DomainSpec(length, sequence=None, material="dna", fixed=False, gc_band=None)gc_band=(lo, hi) enables an early-rejection pre-check that drops out-of-band mutations before objective evaluation.

Mutation policies

RandomMutationPolicy(max_retries=4)
DefectWeightedPolicy(defect_fn, refresh_every=25, epsilon=0.05, fallback=RandomMutationPolicy())
ConstraintAwarePolicy(inner: MutationPolicy)

per_residue_defect_from_ensemble(engine, strand_names, target_structure)
     callable(sequences) -> {name: per_residue_defect_vector}

Leaf decomposition

build_strand_graph(complexes)  dict[str, set[str]]
connected_components(adjacency)  list[set[str]]
decompose_assays(assays: Assay | AssayPanel | list[Assay])  list[Assay]

HardConstraint.propose

HardConstraint(name, fn, proposer=None)
HardConstraint.propose(strand_name, sequence, pos, rng, bases)  base | None

proposer is an optional callable that returns a base known to keep the constraint satisfied; if absent, propose falls back to a bounded reject-resample over bases.

DesignResult

@dataclass
class DesignResult:
    sequences:           dict[str, str]    # domain_name → optimized sequence
    objective_value:     float             # final total score (lower is better)
    objective_breakdown: dict[str, float]  # per-term contributions
    n_iterations:        int
    trial_scores:        list[float]       # best score from each trial
    converged:           bool              # True if final score < 1e-4

LeakageEnumerator

enumerator = LeakageEnumerator(
    engine,
    ddg_threshold=-4.0,       # report reactions with ΔΔG < threshold
    max_complex_size=3,        # 2 = pairs only; 3 = pairs + triplets
    max_pathways=100,
)

report = enumerator.enumerate(
    strands,                  # dict[str, str] — name → sequence
    intended_reactions=None,  # list[str] to exclude from report
)  LeakageReport

LeakageReport

Attribute / method Description
reactions list[SpuriousReaction] sorted by ΔΔG (worst first)
total_spurious Number of spurious reactions found
worst_ddg Most negative ΔΔG across all reactions
summary Human-readable summary string
to_mantis_strings() list[str] — mantis-style reaction strings
filter(ddg_threshold) New LeakageReport keeping only reactions below threshold

TMSDRateSet

@dataclass
class TMSDRateSet:
    kf:             float   # forward rate (M⁻¹ s⁻¹)
    kr:             float   # reverse rate (s⁻¹)
    k_eq:           float   # kf / kr (M⁻¹)
    ddg:            float   # reaction ΔΔG (kcal/mol)
    toehold_length: int
    mechanism:      str     # "toehold_binding" | "branch_migration" | "leakage"

DiskCache

cache = DiskCache(
    path='~/.strider/cache.db',
    max_size_mb=500.0,
    ttl_days=None,         # None = never expire
)

cache.get(key)             # → Any | None
cache.set(key, value)      # → None
cache.stats()              # → dict with hits, misses, hit_rate, entries, size_mb
cache.clear()              # → None (deletes all entries)
cache.close()              # → None (closes SQLite connection)
DiskCache.make_key(*args)  # → str (SHA-256 hex of args)

Examples

All examples are in the examples/ directory and can be run directly. They use the always-available native backend — no external thermodynamic dependency required.

python examples/01_dna_thermodynamics.py
python examples/02_hairpin_folding.py
python examples/03_tmsd_kinetics.py
python examples/04_sequence_design.py
python examples/05_leakage_and_screening.py
python examples/06_parameter_sweep.py
python examples/07_cha_to_mantis.py    # requires mantis-delta
python examples/08_tube_analysis.py
python examples/09_dynamical_design.py  # requires mantis-delta

01_dna_thermodynamics.py — NN model fundamentals

Demonstrates duplex ΔG, melting temperature, salt corrections, and LNA modification energetics. Validates strider's native NN implementation against published SantaLucia & Hicks (2004) values and shows how Owczarzy salt corrections shift Tm by several degrees under physiological conditions.

02_hairpin_folding.py — Structure prediction

Folds a panel of CHA hairpin candidates, draws their arc diagrams, plots mountain vectors, and computes pairwise structural distances. Shows how fold_pseudoknot() identifies structures that the standard MFE algorithm misses.

03_tmsd_kinetics.py — Zhang & Winfree rate model

Reproduces the Zhang & Winfree (2009) kf-vs-toehold-length curve, applies Arrhenius temperature corrections from 20 °C to 60 °C, and demonstrates how rates_from_ddg() propagates thermodynamic uncertainty into kinetic uncertainty. Annotates the 6-nt toehold "sweet spot" at 37 °C.

04_sequence_design.py — Simulated annealing optimization

Designs H1 and H2 sequences for the CHA cascade from scratch: specifies the miRNA-binding domain as a fixed constraint, composes a four-term objective (H1 stability + R1 driving force + spontaneous leakage suppression + GC content), applies HardConstraint.max_run(4) and HardConstraint.gc_content(), and runs 10-trial simulated annealing. Plots trial convergence curves and a mutation sensitivity heatmap for the best result.

05_leakage_and_screening.py — Leakage enumeration and off-target screening

Enumerates all spurious pairwise and tripartite complexes for a set of CHA strands, ranks them by ΔΔG, and adds leakage reactions to a mantis network. Also loads a miRBase FASTA file (miR-21 family) and runs OffTargetScreener to compute selectivity of H1 against closely related miRNA sequences.

06_parameter_sweep.py — Grid sweeps and dose-response

Runs a 2D grid sweep over toehold length and temperature, caches results to disk, and plots a contour map. Also generates a dose-response curve ([miRNA]₀ vs. predicted signal fraction) by sweeping initial conditions through the mantis CRNetwork solver.

07_cha_to_mantis.py — End-to-end integration

The primary validation example. Demonstrates the complete pipeline:

  1. ThermoEngine with native backend at physiological conditions
  2. CHABridge.verify() — seven-check audit (the 0.1.0 API; the new circuits.CHA().verify() runs the same checks via the generic CheckRegistry)
  3. bridge.to_crnetwork() — export to mantis CRNetwork
  4. ODE integration and steady-state finding via mantis
  5. bridge.sensitivity() — one-at-a-time rate sensitivity analysis
  6. Predicted signal vs. miRNA concentration

For non-CHA topologies, swap CHABridge for HCR(...), SeesawGate(logic='AND', ...), Translator(...), or any custom CircuitTemplate subclass — the rest of the pipeline is unchanged.

08_tube_analysis.py — Multi-strand equilibrium

Builds two Tube objects at different total concentrations (100 nM and 10 μM), enumerates monomers + all dimers via SetSpec(max_size=2), runs tube_analysis() once across both tubes, and prints per-species ΔG / equilibrium concentration plus a lazy pair-probability matrix lookup for the heterodimer. Demonstrates the Strand / Complex / ComplexSet / Tube / TubeResult surface end-to-end.

09_dynamical_design.py — Closed-loop dynamical design

Drives sequence optimization from a kinetic cost rather than a static equilibrium defect. Demonstrates the canonical use case from outperform_nupack.md item 1: match a target step-response curve. A single A + B <-> AB hybridization step, with strand A being just the 7-nt designed toehold (no flanking tail), so ΔΔG against the fixed B partner spans ≈ −1 to −8 kcal/mol across all 7-mers — a ≳10⁴× spread in Keq. The example wraps the bridge as a network_factory: (seqs) → mantis.CRNetwork closure, uses DesignObjective.kinetic_trajectory to score the normalized MSE between the simulated AB and the target A₀·(1 − exp(−t/τ)) curve, and lets SequenceDesigner find a toehold that matches. Each SA step rebuilds the CRN with the new sequence and reruns the mantis ODE — the feedback loop is honest. The output plot shows three curves (target, baseline ATATATA plateauing near 0 nM, optimized reaching ~50% of saturation) alongside a per-trial SA convergence bar chart.

10_domain_enumeration.py — Template-free reaction enumeration

Reads strand topology in domain space and derives the reachable complexes plus the bind / 3-way branch-migration / open transitions (the Visual DSD / Peppercorn job), assigns detailed-balance rates from the active ThermoEngine, and hands back a simulable mantis CRNetwork. Runs end-to-end on a textbook TMSD.

11_quadruplex_aptamer.py — K⁺-gated G-quadruplex → electrochemical read-out

Chains fold_quadruplex / quadruplex_ensemble (the §19 G4 layer) into the §18 surface transducer: the K⁺-dependent folded fraction of a telomeric G4 aptamer sets how many tethered redox reporters are in the signal-ON conformation, producing a [K⁺] calibration curve in nA. The whole transduction mechanism — G4 folding — is one NUPACK structurally cannot represent.

12_shot_noise_lod.py — Shot-noise-limited detection

Contrasts the deterministic surface LOD with the §20 stochastic one. The deterministic transducer's infinite-reservoir assumption "captures" thousands of molecules at concentrations where only a handful exist, giving an LOD ~10³× too optimistic; the StochasticSurfaceModel caps capture at the molecule budget, applies the Currie counting-statistics detection limit, and drives the capture as a mantis Gillespie SSA — exposing the Poisson shot-noise floor that actually limits the assay.


Backend comparison

The native backend uses strider's own Zuker MFE and McCaskill O(n³) partition-function DP with nick-aware recursions for multi-strand complexes — the same family of algorithm as ViennaRNA (RNAcofold). Both engines share a single loop-energy module (thermo.ensemble), so MFE and ensemble ΔG cannot drift apart. The multi-strand pfunc applies the σ rotational correction internally (Dirks et al. 2007) so output is species-level.

Performance (single thread, pure Python, no JIT) on random sequences at physiological salt:

length native MFE (median) native pfunc + pair probs (median)
20 nt ~4 ms ~4 ms
50 nt ~50 ms ~85 ms
100 nt ~590 ms ~1.1 s

Reproduce with python scripts/bench_mfe.py.

Accuracy. Stack energies match the source papers exactly (SantaLucia 2004 AA/TT = −1.00 kcal/mol, CG/CG = −2.17, GC/GC = −2.24; Mathews 1999 AU/UA = −0.93). The McCaskill outside recurrence is the exact adjoint of the inside DP: pair probabilities satisfy the unpaired-marginal identity to numerical precision (incl. multiloop-enclosed pairs, which the partition function now scores with a correct ≥2-branch multiloop closure — no stacked-helix double-count and with leading-unpaired bases). This holds for single- and multi-strand complexes alike — the immediate nick-junction pair straddling a strand boundary is exact too, validated against a brute-force enumeration of the model.

Optional Vienna backend. If ViennaRNA is installed and you set backend='vienna', strider routes MFE / pfunc to RNA.fold / RNA.pf_fold. Use it for production-quality folding of sequences > ~200 nt where native runtime becomes the bottleneck. The Tube/ComplexSet API, leakage enumeration, kinetics, and design pipelines work identically on top of either backend.

When to use each backend:

Scenario Recommended backend
Rapid screening / design iteration (< 100 nt) native
Concentration solver / equilibrium analysis native
MFE folding of sequences > 200 nt vienna (optional, opt-in)
No external dependencies (CI, lightweight environments) native (default)
Single-strand / multiloop pair probabilities (exact) native

Running the tests

cd strider
pip install -e .[dev]
pytest tests/ -v

The test suite has 527 tests, all green (1 skipped — a torch/mantis-integration test when the optional dep is not installed; 4 slow benchmark / convergence tests deselected by default, run with pytest -m slow). No external thermodynamic tool is required to run the full suite.

File Tests What is covered
test_thermo_dna.py 16 NN parameters, duplex_dg, Tm, salt corrections, self-complementarity
test_tmsd.py 15 toehold_kf table, Arrhenius correction, detailed balance, leakage_kf, Keq conversions
test_design.py 19 SequenceDesigner SA convergence, DomainSpec, hard constraints, ensemble defect, MutationAnalyzer
test_mfe.py 16 fold_mfe correctness, Zuker full-loop energetics, dot-bracket parsing, mountain vectors
test_sampling.py 11 Boltzmann sampling distribution, subopt enumeration, energy gap correctness
test_equilibrium.py 17 concentration solver convergence, σ correction, water-molarity standard state
test_tube.py 29 Strand / Complex / SetSpec / ComplexSet / Tube / TubeResult / tube_analysis driver
test_parameter_sets.py 31 native ParameterSet adapter, Turner-schema JSON round-trip, engine integration, advanced-table overrides (dangle, terminal mismatch, interior_1_1, hairpin tetraloop, coaxial stack) and the bundled dna-low-salt-50mM-Na.json curated set
test_circuits.py 20 CheckRegistry, CHA/HCR/Translator/SeesawGate templates, custom-registry composition
test_bridge.py 15 CHABridge ddg_pathway, verify() checks, CircuitBridge generic topology, mantis integration
test_dsd.py 15 DSDCompiler domain resolution, strand assembly, bridge integration
test_assay.py 14 Assay/AssayPanel defect, off-target penalty, Assembly↔Complex unification, designer integration
test_design_convergence.py 15 MutationPolicy variants, HardConstraint.propose, leaf decomposition, ensemble-defect tube objective, parallel tempering, early rejection
test_benchmarks.py 14 (+3 slow) Sensitivity / PPV / F-measure metrics, canonical reference dataset, Zhang & Winfree 2009 TMSD lookup self-consistency, runner outputs above the published thresholds
test_formats.py 7 Vienna, CT, BPSEQ, FASTA, oxDNA output; round-trip pair parsing
test_leakage.py 5 LeakageEnumerator pairwise enumeration, pathway classification, filter()
test_screener.py 6 Off-target k-mer screening
test_cotranscriptional.py 9 Prefix-by-prefix folding trajectory, rearrangement detection
test_cli.py 14 strider fold/pfunc/duplex/melt/cotx, JSON output, stdin / @file sequence input
test_differentiable.py 4 ThermoParameters init, batched forward, backward-gradient propagation, toy training step
test_quadruplex.py 22 PQS motif recognition, two-state G4 ΔH/ΔS/Tm, stability/loop/tetrad ordering, K⁺>Na⁺ cation dependence, folded fraction, duplex-vs-G4 partition competition
test_stochastic_surface.py 16 Currie L_C/L_D counting thresholds, k² zero-background floor, detection-probability power curve, depletion-corrected capture mean, shot-noise LOD vs deterministic, mantis SSA matches Poisson

Note: tests requiring mantis-delta are skipped if it is not installed (install via pip install -e ../mantis for editable mode).


Troubleshooting

Multi-strand pair probabilities near a nick

The native McCaskill outside recurrence is the exact adjoint of the inside recurrence: pair probabilities (and TubeResult.defect) satisfy the unpaired-marginal identity Σ_j P(i,j) = 1 − P_unpaired(i) to numerical precision, including pairs inside multiloops (previously underestimated). This now holds for single- and multi-strand complexes at every position — the immediate nick-junction pair (i, i+1) straddling a strand boundary (the coaxial closing pair) is exact too. The earlier over-count there was an artifact of the constrained (unpaired-marginal) partition, not the pair probabilities: forcing a position unpaired must not flip the inter-strand terminal-penalty leaf gate, which is a sequence-only model-shape decision. Validated against an exact brute-force enumeration of the model. Equilibrium concentrations and free energies are unaffected (they consume ΔG only).

CHA().verify() fails spontaneous leakage check

A failing spontaneous_leakage check means H1 and H2 hybridize too favorably in the absence of trigger. Common causes:

  • H1 and H2 have long complementary stems outside the intended domains
  • The stem domain (D2) is too long or too GC-rich
  • The D3 spacer is not introducing enough disruption

Use SequenceDesigner with DesignObjective.minimize_leakage() weighted heavily, or add HardConstraint.no_self_complement(min_length=6) to suppress cross-complementarity. The same applies to any CircuitTemplate that includes a leakage_below_signal check.

Design converges to a high score (> 1.0)

Simulated annealing can get trapped if:

  • Conflicting objectives — e.g. maximizing GC content while minimizing leakage. Check result.objective_breakdown to see which terms dominate.
  • Hard constraints too restrictive — if the constraint space is very small, most mutations get rejected. Try relaxing HardConstraint.gc_content() bounds.
  • Too few iterations — increase max_iterations or n_trials. The trial_scores list shows how much variance there is across restarts.
  • Temperature schedule too fast — lower T_end (e.g. 0.001) to allow finer convergence.

DiskCache.get() always returns None

The cache key is a SHA-256 hash of (operation, material, celsius, sodium, magnesium, sequences). Even a 0.001 °C difference in celsius produces a different key. Make sure you are using the same ThermoEngine instance or identical parameter values across cache reads and writes.


Background and theory

Nearest-neighbor thermodynamic model

The NN model computes duplex stability by summing stacking contributions from every adjacent base-pair step. For a duplex with sequence 5′-X₁X₂…Xₙ-3′, the free energy is:

ΔG = Σᵢ ΔG(XᵢXᵢ₊₁) + ΔG_init(5′ end) + ΔG_init(3′ end) + ΔG_sym

where the sum runs over all n−1 dinucleotide steps, initiation terms account for the terminal base pairs, and a symmetry correction is added if the sequence is self-complementary. The key references are:

  • SantaLucia J Jr, Hicks D (2004). The thermodynamics of DNA structural motifs. Annu. Rev. Biophys. Biomol. Struct. 33, 415–440.
  • SantaLucia J Jr (1998). A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. PNAS 95, 1460–1465.
  • Mathews DH et al. (1999). Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J. Mol. Biol. 288, 911–940.
  • Sugimoto N et al. (1995). Thermodynamic parameters to predict stability of RNA/DNA hybrid duplexes. Biochemistry 34, 11211–11216.

McCaskill partition function DP

The ensemble free energy is computed via the McCaskill (1990) O(n³) dynamic programming algorithm. For multi-strand complexes, strider uses a nick-aware extension: the concatenated sequence has "nick" positions at strand boundaries, and hairpin loops spanning a nick are disallowed. This is the same recursion family used by ViennaRNA (RNAcofold).

  • McCaskill JS (1990). The equilibrium partition function and base pair binding probabilities for RNA secondary structure. Biopolymers 29, 1105–1119.
  • Dirks RM, Pierce NA (2003). A partition function algorithm for nucleic acid secondary structure including pseudoknots. J. Comput. Chem. 24, 1664–1677.

TMSD kinetics

The Zhang & Winfree (2009) empirical model gives kf as a function of toehold length at 25 °C. strider applies an Arrhenius correction with Ea ≈ 20 kcal/mol (validated by Srinivas et al. 2013) to scale to physiological temperature. Reverse rates are derived from detailed balance: kr = kf · exp(ΔΔG/RT).

  • Zhang DY, Winfree E (2009). Control of DNA strand displacement kinetics using toehold exchange. JACS 131, 17303–17314.
  • Srinivas N et al. (2013). Nucleic acids reaction coordinator. Nucleic Acids Res. 41, 10641–10658.

CHA miR-21 biosensor

The Catalytic Hairpin Assembly (CHA) cascade is a DNA nanotechnology circuit in which a microRNA target (miR-21) catalytically drives the formation of a double-stranded reporter complex without any enzymatic amplification. The four-reaction network is:

miRNA + H1   ⇌  miRNA·H1                   (toehold binding / dissociation)
miRNA·H1 + H2 ⇌  H1·H2 + miRNA            (strand exchange / catalyst release)
H1·H2 + CP   ⇌  H1·H2·CP                  (capture probe binding for readout)
H1 + H2      ⇌  H1·H2                      (spontaneous leakage — suppressed)

The miRNA is released intact in the second reaction, allowing it to trigger additional CHA cycles (catalytic turnover). The CHABridge class encodes this topology and automates the verification checks.

Salt corrections

strider applies three salt models, each matched to the calculation that consumes it (all anchored so 1 M Na⁺ / 0 Mg²⁺ is a no-op):

  • Per-base-pair dg_per_bp_salt = c·ln([Na⁺] + 3.4·√[Mg²⁺])·T/T_ref — the folding-engine correction. It is a per-pair quantity, so the McCaskill / Zuker DP can add it to every closed base pair; this is what makes mfe, pfunc, and duplex_dg salt-aware. c = −0.114 (DNA) or ×1.06 for RNA (Tan-Chen per-stack ratio); the dependence is entropic, so it scales with absolute temperature (exact 37 °C anchor).

  • Tan-Chen (2007) tightly-bound-ion model — the hairpin-Tm correction. A whole-helix quantity (needs the stem length N), it reproduces the experimental Mg²⁺ Tm slope on a DNA-beacon qPCR panel (0.71 vs measured ≈0.70 °C/mM) where the other two miss. Default for stems ≥ 6 bp; see §2 Hairpin melting temperature.

  • Owczarzy (2004/2008) — duplex-Tm corrections, selecting between Na⁺-only and Mg²⁺-only by √[Mg²⁺]/[Na⁺]. Used by the oligo melting_temperature path and selectable for hairpins (salt_model="owczarzy"); duplex-calibrated, so it over-shoots Mg²⁺ on short hairpin stems.

  • Tan Z-J & Chen S-J (2007). RNA helix stability in mixed Na⁺/Mg²⁺ solution. Biophys. J. 92, 3615–3632.

  • Owczarzy R et al. (2004). Effects of sodium ions on DNA duplex oligomers. Biochemistry 43, 3537–3554.

  • Owczarzy R et al. (2008). Magnesium ions and DNA. Biochemistry 47, 5336–5353.


Citation

If you use strider-dna in published work, please cite:

@software{venegas2026strider,
  author  = {Venegas, Emilio},
  title   = {strider-dna: Nucleic Acid Thermodynamics, Kinetics, and Circuit Design},
  year    = {2026},
  url     = {https://github.com/EmilioVenegas/strider},
  version = {0.1.0}
}

License

MIT © 2026 Emilio Venegas

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

strider_dna-0.6.0.tar.gz (6.5 MB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

strider_dna-0.6.0-py3-none-any.whl (329.6 kB view details)

Uploaded Python 3

File details

Details for the file strider_dna-0.6.0.tar.gz.

File metadata

  • Download URL: strider_dna-0.6.0.tar.gz
  • Upload date:
  • Size: 6.5 MB
  • Tags: Source
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/6.1.0 CPython/3.13.12

File hashes

Hashes for strider_dna-0.6.0.tar.gz
Algorithm Hash digest
SHA256 291e8ba728a6db06d6284c25866e7eb2af6dfae8fec17dd888d257a59d3274e0
MD5 a775c985fb84bb2f4a985c750ecbc10c
BLAKE2b-256 3454372c8cdbbbdeb307b759e57bcaa7f092bfee1b233bebcdd3d45159acdb34

See more details on using hashes here.

Provenance

The following attestation bundles were made for strider_dna-0.6.0.tar.gz:

Publisher: publish.yaml on EmilioVenegas/strider

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file strider_dna-0.6.0-py3-none-any.whl.

File metadata

  • Download URL: strider_dna-0.6.0-py3-none-any.whl
  • Upload date:
  • Size: 329.6 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/6.1.0 CPython/3.13.12

File hashes

Hashes for strider_dna-0.6.0-py3-none-any.whl
Algorithm Hash digest
SHA256 0601208b6554a4a679aea9a49e6f7b05f8a42365b926d74e70f16a57c9084afe
MD5 06c144c2d4ee114adad7648ee3dee644
BLAKE2b-256 567354b6f055112a3099f37d43fd67433b1f5dc9f6430afa268ec20031047884

See more details on using hashes here.

Provenance

The following attestation bundles were made for strider_dna-0.6.0-py3-none-any.whl:

Publisher: publish.yaml on EmilioVenegas/strider

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page