Skip to main content

A library for the analysis of toehold switch riboregulators.

Project description

ToeholdTools

Build Code style: black

A library for the analysis of toehold switch riboregulators made by the iGEM team City of London UK 2021. We provide tools for characterizing toehold switches for their specificity to the target RNA, with future plans to expand to design tools.

Installation

We distribute CPython wheels for Python 3.6-3.9 in all major operating systems. Unfortunately, there is no use distributing PyPy builds since it not supported by all dependencies.

Before installation, make sure you have downloaded the NUPACK library by following the instructions here.

You can install ToeholdTools from PyPI via pip:

python3 -m pip install thtools -U

Alternatively, you can build the project from source yourself:

python3 -m pip install git+https://github.com/lkn849/thtools.git

Analyzing toehold switches

How it works

We put each set of RNAs you are testing individually into a virtual test tube with the toehold switch. Then, we use the NUPACK amino acid analysis library to simulate the interactions. Finally, we observe the resulting toehold switch secondary structures to see the probability of your toehold switch activating when that set of RNAs is present.

For performance, the majority of the analysis sub-module is compiled via Cython, and uses the Pathos multiprocessing sub-module for distributing work across CPU cores. We are also considering GIL-free processing using OpenMP.

Quick start

If you don't care about full customizability, using the higher level wrapper is recommended:

import thtools as tt

my_test = tt.autoconfig(
    ths = [ # your toehold switch
    "UUAGCCGCUGUCACACGCAC"
    "AGGGAUUUACAAAAAGAGGA"
    "GAGUAAAAUGCUGUGCGUGC"
    "ACCAUAAAACGAACAUAGAC" # NOTE: the lack of commas here is Python syntax for writing a long string across several lines.
    ],
    rbs="AGAGGAGA", # the ribosome binding site you used
    triggers=[ # the set of individual RNAs which potentially trigger the toehold switch you are testing
        "CUGUGCGUGUGACAGCGGCUGA",
        "CUAUACAAUCUACUGUCUUUC",
        "CUGUACAGCCUCCUAGCUUUCC",
    ],
    const_rna=[], # any other strands you want to keep constant and present in every test tube
    set_size=1,
    # autoconfig will generate combinatoric trigger sets of sizes up to and including set_size.
    # Useful for testing logic gate toehold switches.
    # But if you only want to test one a a time as standard, leave as 1.
)
my_results = my_test.run(
    max_size=3,  # the maximum RNA complex size to consider
    n_samples=100,  # the number of Boltzmann samples to take of each complex's secondary structure
)
print(my_results)

autoconfig returns a ToeholdTest instance which can be run as shown above. You can also construct the ToeholdTest yourself, but the parameter requirements are quite specific and it's often easier just to use this utility function to auto-generate it for you. Concentrations of all RNA strands is assumed to be 100nM.

This results in a ToeholdResult instance (which is also stored as the result attribute of the ToeholdTest).

To save the data stored in the ToeholdResult, you can call the .to_csv() method, which will return a csv string you can save to file.

Advanced analysis

Without using the autoconfig function, the direct creation of a ToeholdTest instance is:

import numpy as np
import thtools as tt

ths = { # {sequence : concentration}
    "UUAGCCGCUGUCACACGCAC"
    "AGGGAUUUACAAAAAGAGGA"
    "GAGUAAAAUGCUGUGCGUGC"
    "ACCAUAAAACGAACAUAGAC" : 1e-7
}
rbs_position = slice(34, 42) # slice of the above sequence containing the RBS
trigger_sets = np.array( # each sub-array will be individually tested with the toehold switch
    [["CUGUGCGUGUGACAGCGGCUGA"], 
     ["CUAUACAAUCUACUGUCUUUC"],
     ["CUGUACAGCCUCCUAGCUUUCC"]]
)
conc_sets = np.array( # maps a concentration to each sequence in the trigger_sets
    [[1e-7],
     [1e-7],
     [1e-7]],
    dtype=np.float64
)
const_rna = {} # {sequence : concentration}

my_test = tt.ToeholdTest(ths, rbs_position, trigger_sets, conc_sets, const_rna)
my_results = my_test.run(
    max_size=3,
    n_samples=100,
)
print(my_results)

The trigger_sets and conc_sets array parameters allows you to specify exactly which combinations and concentrations of RNA strands is tested with the toehold switch in each test tube. Concentrations are measured in molar (M).

You can also pass the thermodynamic model to be used using the model argument of both constructors. Otherwise the model is 37°C with 1.0M Na+ and a stacking ensemble. For more information on specifying the model parameters see the NUPACK documentation.

Notes

If you are comparing the results of the tests with the online NUPACK website, it is common for a disparity whereby ToeholdTools suggests an RNA activates the toehold switch but the website disagrees. This is due to a difference in thermodynamic models used, since this package uses a newer, superior version of NUPACK with different default model parameters.

However, if you must emulate the website's behavior, you can specify the model parameters:

import nupack

my_model = nupack.Model(
    ensemble="some-nupack3",
    material="rna95-nupack3",
)

Then you can pass that model as an argument to ToeholdTools.

See also

License

MIT MIT License

Copyright (c) 2021 Lucas Ng

Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions:

The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software.

THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

thtools-0.0.2.tar.gz (1.1 MB view details)

Uploaded Source

Built Distributions

If you're not sure about the file name format, learn more about wheel file names.

thtools-0.0.2-cp39-cp39-win_amd64.whl (1.2 MB view details)

Uploaded CPython 3.9Windows x86-64

thtools-0.0.2-cp39-cp39-win32.whl (1.1 MB view details)

Uploaded CPython 3.9Windows x86

thtools-0.0.2-cp39-cp39-manylinux2010_x86_64.whl (2.1 MB view details)

Uploaded CPython 3.9manylinux: glibc 2.12+ x86-64

thtools-0.0.2-cp39-cp39-manylinux2010_i686.whl (2.1 MB view details)

Uploaded CPython 3.9manylinux: glibc 2.12+ i686

thtools-0.0.2-cp39-cp39-manylinux1_x86_64.whl (2.1 MB view details)

Uploaded CPython 3.9

thtools-0.0.2-cp39-cp39-manylinux1_i686.whl (2.1 MB view details)

Uploaded CPython 3.9

thtools-0.0.2-cp39-cp39-macosx_10_9_x86_64.whl (1.4 MB view details)

Uploaded CPython 3.9macOS 10.9+ x86-64

thtools-0.0.2-cp38-cp38-win_amd64.whl (1.2 MB view details)

Uploaded CPython 3.8Windows x86-64

thtools-0.0.2-cp38-cp38-win32.whl (1.1 MB view details)

Uploaded CPython 3.8Windows x86

thtools-0.0.2-cp38-cp38-manylinux2010_x86_64.whl (2.2 MB view details)

Uploaded CPython 3.8manylinux: glibc 2.12+ x86-64

thtools-0.0.2-cp38-cp38-manylinux2010_i686.whl (2.1 MB view details)

Uploaded CPython 3.8manylinux: glibc 2.12+ i686

thtools-0.0.2-cp38-cp38-manylinux1_x86_64.whl (2.2 MB view details)

Uploaded CPython 3.8

thtools-0.0.2-cp38-cp38-manylinux1_i686.whl (2.1 MB view details)

Uploaded CPython 3.8

thtools-0.0.2-cp38-cp38-macosx_10_9_x86_64.whl (1.4 MB view details)

Uploaded CPython 3.8macOS 10.9+ x86-64

thtools-0.0.2-cp37-cp37m-win_amd64.whl (1.2 MB view details)

Uploaded CPython 3.7mWindows x86-64

thtools-0.0.2-cp37-cp37m-win32.whl (1.1 MB view details)

Uploaded CPython 3.7mWindows x86

thtools-0.0.2-cp37-cp37m-manylinux2010_x86_64.whl (2.0 MB view details)

Uploaded CPython 3.7mmanylinux: glibc 2.12+ x86-64

thtools-0.0.2-cp37-cp37m-manylinux2010_i686.whl (2.0 MB view details)

Uploaded CPython 3.7mmanylinux: glibc 2.12+ i686

thtools-0.0.2-cp37-cp37m-manylinux1_x86_64.whl (2.0 MB view details)

Uploaded CPython 3.7m

thtools-0.0.2-cp37-cp37m-manylinux1_i686.whl (2.0 MB view details)

Uploaded CPython 3.7m

thtools-0.0.2-cp37-cp37m-macosx_10_9_x86_64.whl (1.4 MB view details)

Uploaded CPython 3.7mmacOS 10.9+ x86-64

thtools-0.0.2-cp36-cp36m-win_amd64.whl (1.2 MB view details)

Uploaded CPython 3.6mWindows x86-64

thtools-0.0.2-cp36-cp36m-win32.whl (1.1 MB view details)

Uploaded CPython 3.6mWindows x86

thtools-0.0.2-cp36-cp36m-manylinux2010_x86_64.whl (2.0 MB view details)

Uploaded CPython 3.6mmanylinux: glibc 2.12+ x86-64

thtools-0.0.2-cp36-cp36m-manylinux2010_i686.whl (2.0 MB view details)

Uploaded CPython 3.6mmanylinux: glibc 2.12+ i686

thtools-0.0.2-cp36-cp36m-manylinux1_x86_64.whl (2.0 MB view details)

Uploaded CPython 3.6m

thtools-0.0.2-cp36-cp36m-manylinux1_i686.whl (2.0 MB view details)

Uploaded CPython 3.6m

thtools-0.0.2-cp36-cp36m-macosx_10_9_x86_64.whl (1.4 MB view details)

Uploaded CPython 3.6mmacOS 10.9+ x86-64

File details

Details for the file thtools-0.0.2.tar.gz.

File metadata

  • Download URL: thtools-0.0.2.tar.gz
  • Upload date:
  • Size: 1.1 MB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2.tar.gz
Algorithm Hash digest
SHA256 c15e0522fb3b7bab1548aa4c069f4fc2e1f1de01ac1751e7ed5332803f146c62
MD5 f13ec74811354bca239ead3077956ccc
BLAKE2b-256 b326ac872c64cbeabcf9b8ca47ea5c75f1c1b00ec073a43a26b723b274144204

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp39-cp39-win_amd64.whl.

File metadata

  • Download URL: thtools-0.0.2-cp39-cp39-win_amd64.whl
  • Upload date:
  • Size: 1.2 MB
  • Tags: CPython 3.9, Windows x86-64
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp39-cp39-win_amd64.whl
Algorithm Hash digest
SHA256 aab54d1f9d1db9c7e44051284695fec21f50fd708a20fe9dcdc7afa2e151870c
MD5 608be516d4f23305959e78f7f914e73e
BLAKE2b-256 61e820a80a15603ff643180592648e1e5e5464de3f1df3813da37cd9eeb808db

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp39-cp39-win32.whl.

File metadata

  • Download URL: thtools-0.0.2-cp39-cp39-win32.whl
  • Upload date:
  • Size: 1.1 MB
  • Tags: CPython 3.9, Windows x86
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp39-cp39-win32.whl
Algorithm Hash digest
SHA256 8a20e210636333aa24e785c61fbe9f633bcec77647767f4014fa4fd8f4bbe8d7
MD5 6c1597224e3dbf4812cb0be9b9be4a64
BLAKE2b-256 4db202a278a4f39421a8fb0d786634c68bb4b81f92347fc5ebe2cb822638020c

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp39-cp39-manylinux2010_x86_64.whl.

File metadata

  • Download URL: thtools-0.0.2-cp39-cp39-manylinux2010_x86_64.whl
  • Upload date:
  • Size: 2.1 MB
  • Tags: CPython 3.9, manylinux: glibc 2.12+ x86-64
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp39-cp39-manylinux2010_x86_64.whl
Algorithm Hash digest
SHA256 716c010e18d8b7acf5c1709f876d5342072365ec8c18330a46801592352decac
MD5 eec115faf58232e34e5ac206a03b8aff
BLAKE2b-256 5fba248d9b7406230c1cb3f82518951989fd663f9d5227effe6e51d77b079852

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp39-cp39-manylinux2010_i686.whl.

File metadata

  • Download URL: thtools-0.0.2-cp39-cp39-manylinux2010_i686.whl
  • Upload date:
  • Size: 2.1 MB
  • Tags: CPython 3.9, manylinux: glibc 2.12+ i686
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp39-cp39-manylinux2010_i686.whl
Algorithm Hash digest
SHA256 05ed1f5af6539eda40650b54467685215d12c1b68b7ef54c6d1fc39cc9fe305b
MD5 2946c647981c20a79e5081b56f7ffb19
BLAKE2b-256 f31a356cb8effb0efb5a710e48d5163380bb3c443c40913eab7a03dbcb17758c

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp39-cp39-manylinux1_x86_64.whl.

File metadata

  • Download URL: thtools-0.0.2-cp39-cp39-manylinux1_x86_64.whl
  • Upload date:
  • Size: 2.1 MB
  • Tags: CPython 3.9
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp39-cp39-manylinux1_x86_64.whl
Algorithm Hash digest
SHA256 63a4c228a98ae22aa9147dcc36dcba8097bd8ac2d1189b35e20c7210d16d2a42
MD5 fefd01deb2c3b6234ce4f8c7ba07b3af
BLAKE2b-256 53db6af0f71dd1f57b7a936f8a54cc12e85a799913aa103a376d2e8b72397abe

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp39-cp39-manylinux1_i686.whl.

File metadata

  • Download URL: thtools-0.0.2-cp39-cp39-manylinux1_i686.whl
  • Upload date:
  • Size: 2.1 MB
  • Tags: CPython 3.9
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp39-cp39-manylinux1_i686.whl
Algorithm Hash digest
SHA256 08d21f7bf7befdc43fb15c97de8423d2731a1ee0f828890c9f1c885e44517659
MD5 ccb949aa1d5af10b85aeb30727ba0b38
BLAKE2b-256 f7299ae92da6f32db4651c1c04729d3afb97c7a2291bb330c849329c9a6bfeee

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp39-cp39-macosx_10_9_x86_64.whl.

File metadata

  • Download URL: thtools-0.0.2-cp39-cp39-macosx_10_9_x86_64.whl
  • Upload date:
  • Size: 1.4 MB
  • Tags: CPython 3.9, macOS 10.9+ x86-64
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp39-cp39-macosx_10_9_x86_64.whl
Algorithm Hash digest
SHA256 3ae1d866a154e3dead437c182e07c6140831eec2d8f51d5ed4073cc6f04439e4
MD5 36c8da759f4e1be7f3e1cdbbfbad4856
BLAKE2b-256 9e83b980099fb5e2562cccb5c2c65e594d73045957c7d2f3a0455896681898f8

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp38-cp38-win_amd64.whl.

File metadata

  • Download URL: thtools-0.0.2-cp38-cp38-win_amd64.whl
  • Upload date:
  • Size: 1.2 MB
  • Tags: CPython 3.8, Windows x86-64
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp38-cp38-win_amd64.whl
Algorithm Hash digest
SHA256 ff81df9a14b405138520d79ee76d22f81f9af2fcc3c2fe3e04c6c4cb5b034b6b
MD5 86e603f79f39fbfb74d41cc938cfb3ca
BLAKE2b-256 afc2af39c37c2fd91f7318e97c77c5ff61bcecfbeb343fb306d2e63cd7ac548a

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp38-cp38-win32.whl.

File metadata

  • Download URL: thtools-0.0.2-cp38-cp38-win32.whl
  • Upload date:
  • Size: 1.1 MB
  • Tags: CPython 3.8, Windows x86
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp38-cp38-win32.whl
Algorithm Hash digest
SHA256 d09507c289381177a11c5f34628fde9213ec1e4d63dcfe8a8f7a0802f9d84a93
MD5 0732855e01bd3cc3a9c8505a904b5865
BLAKE2b-256 a5a6176fd0610f375d1cb2342664e42f0f79caf1251aeea780e31f2b1a2ce3db

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp38-cp38-manylinux2010_x86_64.whl.

File metadata

  • Download URL: thtools-0.0.2-cp38-cp38-manylinux2010_x86_64.whl
  • Upload date:
  • Size: 2.2 MB
  • Tags: CPython 3.8, manylinux: glibc 2.12+ x86-64
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp38-cp38-manylinux2010_x86_64.whl
Algorithm Hash digest
SHA256 668b28bfa1fe183353f34e2d9f25cf77ff2442046a5b9effd65cda312c42ad5b
MD5 be4e8e599a1058f7de3ba61fd21d940b
BLAKE2b-256 ebe3125060df645d731060e9770fd6b3437e2183b4e1d89c6bff54280541db2b

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp38-cp38-manylinux2010_i686.whl.

File metadata

  • Download URL: thtools-0.0.2-cp38-cp38-manylinux2010_i686.whl
  • Upload date:
  • Size: 2.1 MB
  • Tags: CPython 3.8, manylinux: glibc 2.12+ i686
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp38-cp38-manylinux2010_i686.whl
Algorithm Hash digest
SHA256 a715d10349bb4887f66ef340ddd59e8b60102116ecd5be0660ea9463a9d9df8d
MD5 fecf3fc8921ce28068a802cc91d8db73
BLAKE2b-256 81bbcd049cb51122438a636671b65d56b969df118a2f204aaaf41c28d979848e

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp38-cp38-manylinux1_x86_64.whl.

File metadata

  • Download URL: thtools-0.0.2-cp38-cp38-manylinux1_x86_64.whl
  • Upload date:
  • Size: 2.2 MB
  • Tags: CPython 3.8
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp38-cp38-manylinux1_x86_64.whl
Algorithm Hash digest
SHA256 47e01526889fe728c0c1a326ba67ec5b5d10cf6bcb2525bb3c7d5743a998950b
MD5 aa761fb72bd7693efc60462c632aac87
BLAKE2b-256 f96bbecd99fe7f7491c441d8802229e071e5d97338d5459e80b80f0108cd0e3a

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp38-cp38-manylinux1_i686.whl.

File metadata

  • Download URL: thtools-0.0.2-cp38-cp38-manylinux1_i686.whl
  • Upload date:
  • Size: 2.1 MB
  • Tags: CPython 3.8
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp38-cp38-manylinux1_i686.whl
Algorithm Hash digest
SHA256 58fab716322f7d9d61c819351aceb676c4c9985da4649dff60035ceb6c5123c2
MD5 9ea97f5581834f85c7294c9d3bf13102
BLAKE2b-256 97346a5f218e4ec2bed1efd0452533906abc0878fdecebe2a2d5e4fc75131749

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp38-cp38-macosx_10_9_x86_64.whl.

File metadata

  • Download URL: thtools-0.0.2-cp38-cp38-macosx_10_9_x86_64.whl
  • Upload date:
  • Size: 1.4 MB
  • Tags: CPython 3.8, macOS 10.9+ x86-64
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp38-cp38-macosx_10_9_x86_64.whl
Algorithm Hash digest
SHA256 1145ffd9565e183f79142c943fdf2e018f36ce0b0f5b0d3b1f381df6167dd4ff
MD5 931d3869bea84e8ad7aafab6e37499a6
BLAKE2b-256 0ed1562c1974966de6e1befc0c9dd0d91563846de6d1211105aa5d8251e762ab

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp37-cp37m-win_amd64.whl.

File metadata

  • Download URL: thtools-0.0.2-cp37-cp37m-win_amd64.whl
  • Upload date:
  • Size: 1.2 MB
  • Tags: CPython 3.7m, Windows x86-64
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp37-cp37m-win_amd64.whl
Algorithm Hash digest
SHA256 85df36778f73de764c282a020b92d50a3684c152edfa843f6842ad7fd2dfec15
MD5 807588019b7e5089a22acbc60b1374fe
BLAKE2b-256 51d2738ba99ae96698db1232614a13c62a70c897b60e5921fca1f2afe405d5a6

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp37-cp37m-win32.whl.

File metadata

  • Download URL: thtools-0.0.2-cp37-cp37m-win32.whl
  • Upload date:
  • Size: 1.1 MB
  • Tags: CPython 3.7m, Windows x86
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp37-cp37m-win32.whl
Algorithm Hash digest
SHA256 493383d1da1e082025d338dbdaa4d277536443e6ee90a3b184be229c14be3e61
MD5 81995a3ac5ca0746a1ca21223ce712ca
BLAKE2b-256 81d2f85f158ddd5e19a0966cc971bf0b136b5bf4127c3966259b2407047833f0

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp37-cp37m-manylinux2010_x86_64.whl.

File metadata

  • Download URL: thtools-0.0.2-cp37-cp37m-manylinux2010_x86_64.whl
  • Upload date:
  • Size: 2.0 MB
  • Tags: CPython 3.7m, manylinux: glibc 2.12+ x86-64
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp37-cp37m-manylinux2010_x86_64.whl
Algorithm Hash digest
SHA256 fda610101fc18f04e7b0bbe122043fced573d3ee4eb1896fb6135b6022bd6ee1
MD5 e6948d351ccf4f360e7d45d5473a99aa
BLAKE2b-256 cd4f33d6df4d88de6840c0149df976a29f25e7559542d7ad9acae5268a7b300a

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp37-cp37m-manylinux2010_i686.whl.

File metadata

  • Download URL: thtools-0.0.2-cp37-cp37m-manylinux2010_i686.whl
  • Upload date:
  • Size: 2.0 MB
  • Tags: CPython 3.7m, manylinux: glibc 2.12+ i686
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp37-cp37m-manylinux2010_i686.whl
Algorithm Hash digest
SHA256 ab4d66446f368b9f98bf3e104250e88d339eb88c7e7d96c2df36e1d4c36ac0a9
MD5 fdf04c50979d47f4c58aa718cc7a4932
BLAKE2b-256 925cecd6b45c8df776b08e7d7bf76b50943a4039654204ea9fdf27292d555cb4

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp37-cp37m-manylinux1_x86_64.whl.

File metadata

  • Download URL: thtools-0.0.2-cp37-cp37m-manylinux1_x86_64.whl
  • Upload date:
  • Size: 2.0 MB
  • Tags: CPython 3.7m
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp37-cp37m-manylinux1_x86_64.whl
Algorithm Hash digest
SHA256 bb947c95f7e1ea41f709407d56883f814a9b371c5f958e56189fb332aaf0bdae
MD5 45a64fa9ea76b9a4786f2da5a0b2d4c2
BLAKE2b-256 4c847d33dfad58fda30208812b0d56fb78cfcc58d38b9fb2951767c5847670bf

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp37-cp37m-manylinux1_i686.whl.

File metadata

  • Download URL: thtools-0.0.2-cp37-cp37m-manylinux1_i686.whl
  • Upload date:
  • Size: 2.0 MB
  • Tags: CPython 3.7m
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp37-cp37m-manylinux1_i686.whl
Algorithm Hash digest
SHA256 5a5fab643bc2869dfdf637f87492612804e53585d627403f89000c42616bfde4
MD5 3abb8d0612a224b745fbf4af01aa6af5
BLAKE2b-256 cd822d913ff7798cecf70d827a44e0d8bfd705a0abdab031befd929f9a50fc6a

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp37-cp37m-macosx_10_9_x86_64.whl.

File metadata

  • Download URL: thtools-0.0.2-cp37-cp37m-macosx_10_9_x86_64.whl
  • Upload date:
  • Size: 1.4 MB
  • Tags: CPython 3.7m, macOS 10.9+ x86-64
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp37-cp37m-macosx_10_9_x86_64.whl
Algorithm Hash digest
SHA256 b157566ac7cb4bb234d43b0dd53ae49d8878cd0db9cf45ce077494c922c08eba
MD5 fef9aaafc231a31509ec5e7466090571
BLAKE2b-256 14f82d326c5142fc975fe690a8e8fcd9546e186a1ce930f731d5df1d5cfd74c5

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp36-cp36m-win_amd64.whl.

File metadata

  • Download URL: thtools-0.0.2-cp36-cp36m-win_amd64.whl
  • Upload date:
  • Size: 1.2 MB
  • Tags: CPython 3.6m, Windows x86-64
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp36-cp36m-win_amd64.whl
Algorithm Hash digest
SHA256 c7a87c8e29b01d3d08b94f6235cf86956d9ec1628145e900e65ed0d9d4157c46
MD5 b38009207d4b5479d464bed377ff3afd
BLAKE2b-256 a521bce6e7656487b721b1511713b84c148b999c7e5515e690edf0593642aaf6

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp36-cp36m-win32.whl.

File metadata

  • Download URL: thtools-0.0.2-cp36-cp36m-win32.whl
  • Upload date:
  • Size: 1.1 MB
  • Tags: CPython 3.6m, Windows x86
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp36-cp36m-win32.whl
Algorithm Hash digest
SHA256 2b7805a67554c01674b5c2cf5e0dc21717dc31764df1030be8f20e9973df9a32
MD5 77faf300a7db92322518d11fef1851f0
BLAKE2b-256 95afebe545020b42b9cf4fdd173bf419da10eb7b777ac0350f702ee486901ab3

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp36-cp36m-manylinux2010_x86_64.whl.

File metadata

  • Download URL: thtools-0.0.2-cp36-cp36m-manylinux2010_x86_64.whl
  • Upload date:
  • Size: 2.0 MB
  • Tags: CPython 3.6m, manylinux: glibc 2.12+ x86-64
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp36-cp36m-manylinux2010_x86_64.whl
Algorithm Hash digest
SHA256 e5b33f3f04fb2a5d512847b12eb70195a63687ed5cc3894ea563ac26c8d0755f
MD5 8f23888077a8ddddfcacc2819368590e
BLAKE2b-256 71533e74b7aefa82f7752f52d593a8a67bee5d5d1aae1d884cb1d7064a94c6a2

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp36-cp36m-manylinux2010_i686.whl.

File metadata

  • Download URL: thtools-0.0.2-cp36-cp36m-manylinux2010_i686.whl
  • Upload date:
  • Size: 2.0 MB
  • Tags: CPython 3.6m, manylinux: glibc 2.12+ i686
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp36-cp36m-manylinux2010_i686.whl
Algorithm Hash digest
SHA256 37ff42a2abffdc8f1d8ead8100293f3c2da9e77394e6b82dc20ecfbdcbe06468
MD5 3c25f68c0a276da50bbe5c6675770090
BLAKE2b-256 05730c8e8731e6e8b713350201ef95a2a95597942420b30bb1a1c3372fb61a1e

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp36-cp36m-manylinux1_x86_64.whl.

File metadata

  • Download URL: thtools-0.0.2-cp36-cp36m-manylinux1_x86_64.whl
  • Upload date:
  • Size: 2.0 MB
  • Tags: CPython 3.6m
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp36-cp36m-manylinux1_x86_64.whl
Algorithm Hash digest
SHA256 6f23f147b1ccb3df4e00bb1cd501d7e90b6edaee3857b5fdf4c7b65a1a39d56b
MD5 69ef21e2526055b9e09374e3cd6ed496
BLAKE2b-256 857facfdb7160ca7c32b081ac617dc25c40010b18d429698400a1eaf6c5688a0

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp36-cp36m-manylinux1_i686.whl.

File metadata

  • Download URL: thtools-0.0.2-cp36-cp36m-manylinux1_i686.whl
  • Upload date:
  • Size: 2.0 MB
  • Tags: CPython 3.6m
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp36-cp36m-manylinux1_i686.whl
Algorithm Hash digest
SHA256 b4c536ee0d09f8c07c5ff15540e62f695355d6621a83b23a6e5ac737f9e736e1
MD5 2beebb7a03925bfc61e3875f73bd0d56
BLAKE2b-256 9048fc94346b3bed959c6ddd31ad81360ae7a0b42055e0fd3730774f11ca332c

See more details on using hashes here.

File details

Details for the file thtools-0.0.2-cp36-cp36m-macosx_10_9_x86_64.whl.

File metadata

  • Download URL: thtools-0.0.2-cp36-cp36m-macosx_10_9_x86_64.whl
  • Upload date:
  • Size: 1.4 MB
  • Tags: CPython 3.6m, macOS 10.9+ x86-64
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/4.6.1 pkginfo/1.7.0 requests/2.25.1 requests-toolbelt/0.9.1 tqdm/4.57.0 CPython/3.8.8

File hashes

Hashes for thtools-0.0.2-cp36-cp36m-macosx_10_9_x86_64.whl
Algorithm Hash digest
SHA256 60b89c93c052822ec5a42c002c6ae8fa3059c8c1be5c0bb3236885ad2d2e7bba
MD5 ec77d099fa6b7bf5901fd0e827f2230c
BLAKE2b-256 76284b799306f7addcbe7b791dc39248559aa530909a167cabedd1898439bbad

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page