TRACE: Triple-aligner Read Analysis for CRISPR Editing
Project description
TRACE
Triple-aligner Read Analysis for CRISPR Editing
Features
- Triple-aligner consensus: Uses BWA-MEM, BBMap, and minimap2 for robust alignment
- Automatic inference: Detects PAM, cleavage site, homology arms, and edits from sequences
- K-mer classification: Fast pre-alignment HDR/WT detection using 12-mers
- Multi-nuclease support: Cas9 and Cas12a (Cpf1) with correct cleavage geometry
- Auto-detection: Library type (TruSeq/Tn5), read merging need, CRISPResso mode
- CRISPResso2 integration: Validation with standard CRISPR analysis tool
Installation
pip (Python package only)
pip install trace-crispr
conda (includes external aligners)
conda install -c bioconda -c conda-forge trace-crispr
Development installation
git clone https://github.com/k-roy/trace.git
cd trace
pip install -e ".[dev]"
Quick Start
Minimal run (3 required inputs)
trace run \
--reference amplicon.fasta \
--hdr-template hdr_template.fasta \
--guide GCTGAAGCACTGCACGCCGT \
--r1 sample_R1.fastq.gz \
--r2 sample_R2.fastq.gz \
--output results/
Check locus configuration without running
trace info \
--reference amplicon.fasta \
--hdr-template hdr_template.fasta \
--guide GCTGAAGCACTGCACGCCGT
This will print:
=== TRACE Analysis Configuration ===
Reference sequence: 500 bp
HDR template: 500 bp
Donor template analysis:
- Left homology arm: positions 1-245 on reference (245 bp)
- Right homology arm: positions 255-500 on reference (245 bp)
- Donor edits detected at positions: 246, 247 on reference
* Position 246: C → G (PAM-silencing mutation)
* Position 247: C → T (chromophore Y66H mutation)
Guide analysis:
- Guide sequence: GCTGAAGCACTGCACGCCGT
- Guide targets: positions 248-267 on reference (- strand)
- PAM: GGG at positions 245-247 on reference
- Cleavage site: position 248 on reference
Multiple samples
Create a sample key TSV:
sample_id r1_path r2_path condition
sample_1 /path/to/S1_R1.fastq.gz /path/to/S1_R2.fastq.gz treatment
sample_2 /path/to/S2_R1.fastq.gz /path/to/S2_R2.fastq.gz control
Then run:
trace run \
--reference amplicon.fasta \
--hdr-template hdr_template.fasta \
--guide GCTGAAGCACTGCACGCCGT \
--sample-key samples.tsv \
--output results/ \
--threads 16
Using Cas12a
trace run \
--reference amplicon.fasta \
--hdr-template hdr_template.fasta \
--guide GCTGAAGCACTGCACGCCGTAA \
--nuclease cas12a \
--sample-key samples.tsv \
--output results/
Nuclease Support
Cas9 (SpCas9)
- PAM: NGG (3' of protospacer)
- Cleavage: 3 bp upstream of PAM (blunt ends)
Cas12a (LbCpf1)
- PAM: TTTN (5' of protospacer)
- Cleavage: 18-19 bp downstream on target strand, 23 bp on non-target
- Creates 4-5 nt 5' overhang (staggered cut)
Output
The main output is a TSV file with per-sample editing outcomes:
| Column | Description |
|---|---|
| sample | Sample ID |
| classifiable_reads | Total classifiable reads |
| duplicate_rate | PCR duplicate rate (Tn5) |
| Dedup_WT_% | Wild-type % (deduplicated) |
| Dedup_HDR_% | HDR % (deduplicated) |
| Dedup_NHEJ_% | NHEJ % (deduplicated) |
| Dedup_LgDel_% | Large deletion % |
| kmer_hdr_rate | K-mer method HDR rate |
| crispresso_hdr_rate | CRISPResso2 HDR rate |
Dependencies
Python
- click>=8.0
- pysam>=0.20
- pandas>=1.5
- numpy>=1.20
- pyyaml>=6.0
- rapidfuzz>=3.0
- tqdm>=4.60
External tools (via conda)
- bwa>=0.7
- bbmap>=39
- minimap2>=2.24
- samtools>=1.16
- crispresso2 (optional, but enabled by default)
Author
Kevin R. Roy
License
MIT
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
trace_crispr-0.1.0.tar.gz
(41.9 kB
view details)
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file trace_crispr-0.1.0.tar.gz.
File metadata
- Download URL: trace_crispr-0.1.0.tar.gz
- Upload date:
- Size: 41.9 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.2.0 CPython/3.12.2
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
760228fcdc26323af593a331e43a68bc111af4237d29631644b76c0961bd71eb
|
|
| MD5 |
e5cc6ee3ec32a852d14407df492e643c
|
|
| BLAKE2b-256 |
19410219478305e61b012447a36940d4970a049071ab3c30ccd55602a922e52a
|
File details
Details for the file trace_crispr-0.1.0-py3-none-any.whl.
File metadata
- Download URL: trace_crispr-0.1.0-py3-none-any.whl
- Upload date:
- Size: 50.2 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.2.0 CPython/3.12.2
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
b406816c48ea374b4d0ecc440c4f8e37631bccdc83ea43e1eb9c2f45a02be4a7
|
|
| MD5 |
34416d6ab342ba5c561ad242608d4ad6
|
|
| BLAKE2b-256 |
b15ce98a52ac0b2db2ab8db0aa7dcc3bb02e80c67fca2d576e53dc545cf82b5e
|