trviz 1.4.2

A python library for decomposing and visualizing tandem repeat sequences

  _______ _______      _______ ______
 |__   __|  __ \ \    / /_   _|___  /
    | |  | |__) \ \  / /  | |    / /
    | |  |  _  / \ \/ /   | |   / /
    | |  | | \ \  \  /   _| |_ / /__
    |_|  |_|  \_\  \/   |_____/_____|

TRviz is a python library for analyzing tandem repeat sequences. TRviz includes modules for decomposing, encoding, aligning, and visualizing tandem repeat sequences.

Quick Start

Prerequisites

• Python 3.10+ (3.10, 3.11, or 3.12 are tested)
• MAFFT (for multiple sequence alignment) — install from MAFFT website. Tested with v7.505.

Install

pip install trviz

Or from source:

git clone https://github.com/Jong-hun-Park/trviz.git
cd trviz/
pip install .

Run your first analysis

Check out our Jupyter notebook for code examples.

Features Overview

Input and output

Input

1. Tandem repeat sequences (alleles)
2. A set of motifs for decomposition

Output

1. A plot showing the motif composition of the input sequences (PDF by default)
2. A plot mapping color to motif (PDF by default)
3. Aligned and labeled motifs (text file)
4. Motif map: a set of motifs detected in the samples and their labels and frequencies (text file)

For more detailed descriptions, see the full documentation at readthedocs.

Code examples

Generate a plot (saves to disk)

from trviz.main import TandemRepeatVizWorker
from trviz.utils import get_sample_and_sequence_from_fasta

tr_visualizer = TandemRepeatVizWorker()
sample_ids, tr_sequences = get_sample_and_sequence_from_fasta(fasta_file_path)
tr_id = "CACNA1C"
motifs = ['GACCCTGACCTGACTAGTTTACAATCACAC']

tr_visualizer.generate_trplot(tr_id, sample_ids, tr_sequences, motifs)

Customize the plot via matplotlib (v1.4.0+)

generate_trplot() and the underlying trplot() / plot_motif_color_map() now return (fig, ax), so you can apply any matplotlib styling — fonts, ticks, titles, layout — before saving the figure yourself.

fig, ax = tr_visualizer.generate_trplot(
    tr_id, sample_ids, tr_sequences, motifs,
    save=False,                       # skip the built-in savefig
)

# Apply any matplotlib styling you want:
ax.set_title("CACNA1C VNTR composition", fontsize=14)
ax.tick_params(axis="x", labelsize=12)
ax.set_xlabel("Repeat unit", fontsize=12)

fig.savefig("CACNA1C.pdf", dpi=300, bbox_inches="tight")

You can also draw the plot into your own ax (useful for embedding in a multi-panel figure):

import matplotlib.pyplot as plt

fig, axes = plt.subplots(1, 2, figsize=(16, 6))
tr_visualizer.visualizer.trplot(
    aligned_labeled_repeats=aligned_trs,
    sample_ids=sorted_sample_ids,
    symbol_to_motif=symbol_to_motif,
    ax=axes[0],                       # draw into your own axes
    sort_by_clustering=False,
)
# ... draw something else into axes[1] ...
fig.savefig("multi_panel.pdf")

Motif decomposition

from trviz.decomposer import Decomposer

tr_decomposer = Decomposer()
tr_sequence = "ACCTTGACCTTGACCTTGACCTTG"
motifs = ["ACCTTG"]
tr_decomposer.decompose(tr_sequence, motifs)
# >>> ["ACCTTG", "ACCTTG", "ACCTTG", "ACCTTG"]

Citation

Jonghun Park, Eli Kaufman, Paul N Valdmanis, Vineet Bafna, TRviz: a Python library for decomposing and visualizing tandem repeat sequences, Bioinformatics Advances, Volume 3, Issue 1, 2023, vbad058.

Contribute

Your feedback is valuable! If you encounter any issues during installation or usage, please submit them in the TRviz GitHub Issues.