Tooling for ultra-high throughput screening workflows.
Project description
uht-tooling
Automation helpers for ultra-high-throughput molecular biology workflows. The package ships both a CLI and an optional GUI that wrap the same workflow code paths.
Installation
Python version: 3.10
Quick install (recommended, easiest file maintainance)
pip install "uht-tooling[gui]"
This installs the core workflows plus the optional GUI dependency (NiceGUI). NiceGUI is already included in the core dependencies, so [gui] is a convenience alias. Omit the [gui] extras if you only need the CLI:
pip install uht-tooling
Legacy Gradio interface: The old Gradio GUI is still available via
pip install "uht-tooling[legacy-gui]"and launched withuht-tooling gui --legacy.
External Tools
Some workflows require external bioinformatics tools:
| Workflow | Required Tools |
|---|---|
| mutation-caller | mafft |
| umi-hunter | mafft |
| ep-library-profile | minimap2, NanoFilt |
| ssm-profiler | minimap2 |
Install via conda:
conda install -c bioconda mafft minimap2 nanofilt
The CLI and GUI will validate tool availability before running and provide clear error messages if tools are missing.
Development install
git clone https://github.com/Matt115A/uht-tooling-packaged.git
cd uht-tooling-packaged
python -m pip install -e ".[gui,dev]"
The editable install exposes the latest sources, while the dev extras add linting and test tooling.
Directory layout
- Reference inputs can be found anywhere (you specify in the cli), but we recommend using
data/<workflow>/. - Outputs (CSV, FASTA, plots, logs) are written to
results/<workflow>/. - All workflows log to
results/<workflow>/run.logfor reproducibility and debugging.
Command-line interface
The CLI is exposed as the uht-tooling executable. List the available commands:
uht-tooling --help
Each command mirrors a workflow module. Common entry points:
| Command | Purpose |
|---|---|
uht-tooling nextera-primers |
Generate Nextera XT primer pairs from a binding-region CSV. |
uht-tooling design-gene-oligos |
Design overlap-extension PCR oligos for IVTT-ready gene constructs. |
uht-tooling design-synthetic-gene-pool |
Design pooled synthetic-gene ordering oligos plus a reusable lift-out primer pair. |
uht-tooling design-slim |
Design SLIM mutagenesis primers from FASTA/CSV inputs. |
uht-tooling design-kld |
Design KLD (inverse PCR) mutagenesis primers. |
uht-tooling design-gibson |
Produce Gibson mutagenesis primers and assembly plans. |
uht-tooling mutation-caller |
Summarise amino-acid substitutions from long-read FASTQ files. |
uht-tooling umi-hunter |
Cluster UMIs and call consensus genes. |
uht-tooling ep-library-profile |
Measure mutation rates in plasmid libraries without UMIs. |
uht-tooling ssm-profiler |
Profile site-saturation libraries at target codons and compare observed vs expected AA distributions. |
uht-tooling profile-inserts |
Extract and analyse inserts defined by flanking probe pairs. |
Each command provides detailed help, including option descriptions and expected file formats:
uht-tooling mutation-caller --help
Short Flags
All commands support short flags for common options:
# Long form
uht-tooling design-slim --gene-fasta gene.fa --context-fasta ctx.fa --mutations-csv mut.csv --output-dir out/
# Short form
uht-tooling design-slim -g gene.fa -c ctx.fa -m mut.csv -o out/
| Long Flag | Short | Commands |
|---|---|---|
--gene-fasta |
-g |
design-slim, design-kld, design-gibson |
--context-fasta |
-c |
design-slim, design-kld, design-gibson |
--mutations-csv |
-m |
design-slim, design-kld, design-gibson |
--sequence-fasta |
-s |
design-gene-oligos |
--sequence-fasta |
-s |
design-synthetic-gene-pool |
--output-dir |
-o |
8 commands |
--log-path |
-l |
8 commands |
--template-fasta |
-t |
mutation-caller, umi-hunter |
--fastq |
-q |
5 commands |
--threshold |
-T |
mutation-caller |
--config-csv |
-C |
umi-hunter |
--binding-csv |
-b |
nextera-primers |
--probes-csv |
-P |
profile-inserts |
--region-fasta |
-R |
ep-library-profile, ssm-profiler |
--plasmid-fasta |
-p |
ep-library-profile, ssm-profiler |
--work-dir |
-w |
ep-library-profile, ssm-profiler |
--target-site |
-t |
ssm-profiler |
--site-scheme |
-s |
ssm-profiler |
--config |
-K |
global (all commands) |
You can pass multiple FASTQ paths using repeated --fastq options or glob patterns. Optional --log-path flags redirect logs if you prefer a location outside the default results directory.
Configuration File
uht-tooling supports a YAML configuration file for default options.
Auto-discovery locations (in order):
$UHT_TOOLING_CONFIGenvironment variable~/.uht-tooling.yaml~/.config/uht-tooling/config.yaml.uht-tooling.yaml(current directory)
Or specify explicitly: uht-tooling --config my-config.yaml ...
Example ~/.uht-tooling.yaml:
paths:
output_dir: ~/results/uht-tooling
defaults:
design_gene_oligos:
target_oligo_length: 40
mutation_caller:
threshold: 15
umi_hunter:
umi_identity_threshold: 0.85
min_cluster_size: 5
gene_oligos:
constant_5prime_dna: TAATACGACTCACTATAGGGAGA
constant_3prime_dna: GCGTTTTTTTTT
stop_codon: TAA
tags:
n_his:
dna: CATCATCATCATCATCAT
c_his:
dna: CATCATCATCATCATCAT
n_his_flag:
dna: CATCATCATCATCATCATGACTACAAAGACGATGACGACAAG
c_his_flag:
dna: CATCATCATCATCATCATGACTACAAAGACGATGACGACAAG
codon_table:
A: GCT
C: TGT
D: GAT
E: GAA
F: TTT
G: GGT
H: CAT
I: ATT
K: AAA
L: CTG
M: ATG
N: AAT
P: CCT
Q: CAA
R: CGT
S: TCT
T: ACT
V: GTT
W: TGG
Y: TAT
CLI options always take precedence over config values.
Workflow reference
Gene oligo designer
Design one or more IVTT-ready constructs from DNA or protein FASTA input and tile them into overlap-extension PCR oligos.
The workflow has built-in T7 defaults for the 5' cassette, 3' terminator, and common His/His+FLAG tags. Protein inputs are automatically codon-optimized for the selected host using dnachisel; DNA inputs are preserved apart from start/stop normalization.
Inputs:
--sequence-fasta— FASTA containing one or more GOIs as DNA or protein--input-type—auto,dna, orprotein--target-oligo-length— maximum allowed gene-specific oligo length in nt (minimum20, default40); the workflow chooses the longest feasible size at or below this limit to minimize primer count--max-orderonce-length— maximum allowed length for reusable constant oligos (default80)--target-host— host identifier used for automatic protein codon optimization (defaulte_coli)--tag-mode—none,n_his,c_his,n_his_flag, orc_his_flag--output-dir— destination for oligos, construct FASTA, and run log
Outputs:
gene_oligos.csv— per-target OE oligos plus reusable external primers, with overlap metrics,constantvsgene_specificrole, andorder_oncevsorder_per_targetassembly_report.csv— one row per target with start/stop-codon normalization and recommended assembly strategyfinal_constructs.fasta— assembled IVTT-ready constructs for all targetsordered_oligos.fasta— deduplicated oligos in 5'→3' ordering orientationordering_plate.csv— 96-well plate layout at 20 uM stock concentrationexternal_primers.csv— reusable outer primers for production-scale full-length amplificationassembly_instructions.txt— suggested OE-PCR workflow and block-assembly guidance
Reusable edge oligos are emitted as CONST_EDGE_5P and CONST_EDGE_3P. These are the preferred order_once oligos and are allowed to be longer than the per-target OE oligos so they can absorb the promoter, start codon, terminator, and any configured terminal tag. In the web UI, the maximum allowed length for these reusable oligos is available under the collapsed Extra settings panel.
Example:
uht-tooling --config .uht-tooling.yaml design-gene-oligos \
--sequence-fasta data/gene_oligos/target.fasta \
--input-type protein \
--target-oligo-length 40 \
--tag-mode n_his \
--output-dir results/design_gene_oligos/
If you do not provide a gene_oligos: section in your YAML config, the built-in defaults are used automatically.
The workflow auto-detects and removes terminal stop codons from the user input, adds a start codon when an untagged or C-terminally tagged construct lacks one, and inserts an initiating ATG immediately before an N-terminal tag. For protein inputs, host-aware codon optimization is applied automatically before oligo design.
Synthetic gene pool
Design a pooled ordering set for E. coli T7 cell-free protein synthesis where each target is represented by one oligo flanked by shared lift-out handles, and a single reusable primer pair adds the final 5' and 3' constant regions plus optional tags.
Inputs:
--sequence-fasta— FASTA containing one or more GOIs as DNA or protein--input-type—auto,dna, orprotein--tag-mode—none,n_his,c_his,n_his_flag, orc_his_flag--output-dir— destination for pool-ordering outputs
Outputs:
synthetic_gene_pool.csv— one pooled oligo per targetsynthetic_gene_pool_primers.csv— common forward/reverse lift-out primers to order oncesynthetic_gene_pool_ordering.tsv— copy/paste-ready ordering list containing all pool oligos and the common primerssynthetic_gene_pool_instructions.txt— brief workflow guidance
Protein inputs are automatically codon-optimized for E. coli. The pooled oligos are kept short by including only the shared anneal handles, while the reusable common primers contribute the full T7/cell-free 5' and 3' payload. The common primers must stay below 100 bp; the workflow fails if the configured constant/tag payload would exceed that limit.
Example:
uht-tooling design-synthetic-gene-pool \
--sequence-fasta data/synthetic_genes/targets.fasta \
--input-type protein \
--tag-mode n_his \
--output-dir results/synthetic_gene_pool/
Nextera XT primer design
Inputs:
--binding-csv— CSV with abinding_regioncolumn (row 1 = i7 forward region, row 2 = i5 reverse region, both 5'→3')--output-csv— path for the output primer CSV
Outputs:
- Single CSV with columns
[primer_name, sequence]
- Prepare
data/nextera_designer/nextera_designer.csvwith abinding_regioncolumn. Row 1 should contain the forward region, row 2 the reverse region, both in 5'→3' orientation. - Optional: supply a YAML overrides file for index lists/prefixes via
--config. - Run:
uht-tooling nextera-primers \ --binding-csv data/nextera_designer/nextera_designer.csv \ --output-csv results/nextera_designer/nextera_xt_primers.csv
- Primer CSVs will be written to
results/nextera_designer/, accompanied by a log file.
The helper is preloaded with twelve i5 and twelve i7 indices, enabling up to 144 unique amplicons.
Wet-lab workflow notes
- Perform the initial amplification with an i5/i7 primer pair and monitor a small aliquot by qPCR. Cap thermocycling early so you only generate ~10% of the theoretical yield—this minimizes amplification bias.
- Purify the product with SPRIselect beads at approximately a 0.65:1 bead:DNA volume ratio to remove residual primers and short fragments.
- Confirm primer removal and quantify DNA using electrophoresis (e.g., BioAnalyzer DNA chip) before moving to the flow cell.
SLIM primer design
- Inputs:
data/design_slim/slim_template_gene.fastadata/design_slim/slim_context.fastadata/design_slim/slim_target_mutations.csv(singlemutationscolumn)
- Run:
uht-tooling design-slim \ --gene-fasta data/design_slim/slim_template_gene.fasta \ --context-fasta data/design_slim/slim_context.fasta \ --mutations-csv data/design_slim/slim_target_mutations.csv \ --output-dir results/design_slim/
Outputs:
SLIM_primers.csv— columns[Primer Name, Sequence], 4 primers per mutation (_Lf,_Sr,_Lr,_Sf)
Mutation nomenclature examples:
A123G(substitution)T241Del(deletion)T241TS(insert Ser after Thr241)L46GP(replace Leu46 with Gly-Pro)A123:NNK(library mutation with degenerate codon)
Library mutations with degenerate codons
For saturation mutagenesis and library generation, SLIM supports degenerate (IUPAC ambiguity) codons using the format <WT_AA><position>:<codon>. The codon must be exactly 3 characters using valid IUPAC nucleotide codes:
| Code | Bases | Mnemonic |
|---|---|---|
| A, C, G, T | Single base | Standard |
| R | A, G | puRine |
| Y | C, T | pYrimidine |
| S | G, C | Strong |
| W | A, T | Weak |
| K | G, T | Keto |
| M | A, C | aMino |
| B | C, G, T | not A |
| D | A, G, T | not C |
| H | A, C, T | not G |
| V | A, C, G | not T |
| N | A, C, G, T | aNy |
Common degenerate codon schemes for library construction:
| Scheme | Codons | Amino acids | Stop codons | Notes |
|---|---|---|---|---|
| NNK | 32 | 20 | 1 (TAG) | Reduced stop codon frequency |
| NNS | 32 | 20 | 1 (TAG) | Equivalent to NNK |
| NNN | 64 | 20 | 3 | All codons, higher stop frequency |
| NDT | 12 | 12 | 0 | F, L, I, V, Y, H, N, D, C, R, S, G only |
Example CSV with mixed mutation types:
mutations
A123G
T50:NNK
S100:NNS
T241Del
The workflow validates that the wild-type amino acid matches the template sequence and logs library coverage information (number of possible codons and amino acids) for each degenerate mutation. Primers are generated with the degenerate bases embedded; reverse primers contain the correct IUPAC reverse complements (e.g., K↔M, R↔Y, S↔S).
Experimental blueprint
- Hands-on time is approximately three hours (excluding protein purification), with mutant protein obtainable in roughly three days.
- Conduct two PCRs per mutant set: (A) long forward with short reverse and (B) long reverse with short forward.
- Combine 10 µL from each PCR with 10 µL H-buffer (150 mM Tris pH 8, 400 mM NaCl, 60 mM EDTA) for a 30 µL annealing reaction: 99 °C for 3 min, then two cycles of 65 °C for 5 min followed by 30 °C for 15 min, hold at 4 °C.
- Transform directly into NEB 5-alpha or BL21 (DE3) cells without additional cleanup. The protocol has been validated for simultaneous introduction of dozens of mutations.
KLD primer design
KLD (Kinase-Ligation-DpnI) is an alternative mutagenesis method using inverse PCR to amplify the entire plasmid with mutations incorporated at the primer junction.
- Inputs: Same as SLIM design
data/design_kld/kld_template_gene.fastadata/design_kld/kld_context.fastadata/design_kld/kld_target_mutations.csv(singlemutationscolumn)
- Run:
uht-tooling design-kld \ --gene-fasta data/design_kld/kld_template_gene.fasta \ --context-fasta data/design_kld/kld_context.fasta \ --mutations-csv data/design_kld/kld_target_mutations.csv \ --output-dir results/design_kld/
Outputs:
KLD_primers.csv— columns[Primer Name, Sequence, Tm (binding), GC%, Length, Notes], 2 primers per mutation (_F,_R)
Mutation nomenclature: Same as SLIM (substitution, deletion, insertion, indel, library).
KLD vs SLIM
| Method | Primers | Mechanism | Best for |
|---|---|---|---|
| SLIM | 4 per mutation | Overlap assembly | Multiple simultaneous mutations |
| KLD | 2 per mutation | Inverse PCR + ligation | Single mutations, simpler workflow |
KLD primer design rules
- Forward primer: Mutation codon at 5' end + downstream template-binding region
- Reverse primer: Reverse complement of upstream region, 5' end adjacent to forward
- Tm calculated on template-binding regions only (50-65°C target)
- Tm difference between primers kept within 5°C
- GC content 40-60%
- Binding region 18-24 bp
Experimental workflow
- PCR amplify entire plasmid with KLD primer pair
- DpnI digest to remove methylated template
- T4 PNK phosphorylation of 5' ends
- T4 DNA ligase to circularize
- Transform into competent cells
NEB sells a KLD Enzyme Mix (M0554) that combines these steps.
Gibson assembly primers
- Inputs mirror the SLIM workflow but use
data/design_gibson/. - Link sub-mutations with
+to specify multi-mutation assemblies (e.g.,A123G+T150A). - Run:
uht-tooling design-gibson \ --gene-fasta data/design_gibson/gibson_template_gene.fasta \ --context-fasta data/design_gibson/gibson_context.fasta \ --mutations-csv data/design_gibson/gibson_target_mutations.csv \ --output-dir results/design_gibson/
Outputs:
Gibson_primers.csv— columns[Group, Submutation, Primer Name, Sequence]Gibson_assembly_plan.csv— columns[Group, Submutation, PCR_Primer_Forward, PCR_Primer_Reverse, Tm (celsius), Amplicon Size (bp)]
If mutations fall within overlapping primer windows, design sequential reactions.
Mutation caller (no UMIs)
- Supply:
data/mutation_caller/mutation_caller_template.fastadata/mutation_caller/mutation_caller.csvwithgene_flanksandgene_min_maxcolumns (two rows each).- One or more FASTQ files via
--fastq.
- Run:
uht-tooling mutation-caller \ --template-fasta data/mutation_caller/mutation_caller_template.fasta \ --flanks-csv data/mutation_caller/mutation_caller.csv \ --fastq data/mutation_caller/*.fastq.gz \ --output-dir results/mutation_caller/ \ --threshold 10
Outputs: per-sample subdirectory containing:
{sample}_aa_substitution_frequency.png— substitution frequency plot with KDE{sample}_frequent_aa_counts.csv— columns[AA, Count](filtered by--threshold){sample}_cooccurring_AA_baseline.csv— columns[AA1, AA2, Both_Count, AA1_Count, AA2_Count]{sample}_cooccurring_AA_fisher.csv— columns[AA1, AA2, p-value]{sample}_report.txt— summary report
Co-occurrence matrices are experimental and are not yet to be relied on.
UMI Hunter
- Inputs:
data/umi_hunter/template.fasta,data/umi_hunter/umi_hunter.csv, and FASTQ reads. - Command:
uht-tooling umi-hunter \ --template-fasta data/umi_hunter/template.fasta \ --config-csv data/umi_hunter/umi_hunter.csv \ --fastq data/umi_hunter/*.fastq.gz \ --output-dir results/umi_hunter/
- Tunable parameters include
--umi-identity-threshold,--consensus-mutation-threshold, and--min-cluster-size. --umi-identity-threshold(0–1) controls how similar two UMIs must be to fall into the same cluster.--consensus-mutation-threshold(0–1) is the fraction of reads within a cluster that must agree on a base before it is written into the consensus sequence.--min-cluster-sizesets the minimum number of reads required in a cluster before a consensus is generated (smaller clusters remain listed in the raw UMI CSV but no consensus FASTA is produced).
Outputs: per-sample subdirectory containing:
{sample}_UMI_clusters.csv— columns[Cluster Representative, Total Count, Members]{sample}_gene_consensus.csv— columns[Cluster Representative, Total Count, Consensus Gene, Length Difference, Members]{sample}_consensuses.fasta— FASTA with consensus sequences (only for clusters ≥--min-cluster-size)
Please be aware, this toolkit will not scale well beyond around 50k reads/sample. See UMIC-seq pipelines for efficient UMI-gene dictionary generation.
Profile inserts
- Prepare
data/profile_inserts/sample_probes.csvwithupstreamanddownstreamcolumns. - Run:
uht-tooling profile-inserts \ --probes-csv data/profile_inserts/sample_probes.csv \ --fastq data/profile_inserts/*.fastq.gz \ --output-dir results/profile_inserts/
Outputs:
extracted_inserts.fasta— all extracted insert sequencesqc_report.txt— summary statistics (lengths, GC, duplicates, probe performance)qc_plots.png— multi-panel QC figure
Adjust fuzzy matching strictness via --min-ratio.
EP library profiler (no UMIs)
- Inputs:
data/ep-library-profile/region_of_interest.fastadata/ep-library-profile/plasmid.fasta- FASTQ inputs (
--fastqaccepts multiple files)
- ROI matching:
- The region-of-interest sequence can be forward, reverse-complemented, or split across the plasmid origin.
- The plasmid FASTA is treated as circular for ROI matching and background exclusion.
- The ROI still needs to be unique within the plasmid; ambiguous multi-hit matches are rejected.
- Run:
uht-tooling ep-library-profile \ --region-fasta data/ep-library-profile/region_of_interest.fasta \ --plasmid-fasta data/ep-library-profile/plasmid.fasta \ --fastq data/ep-library-profile/*.fastq.gz \ --output-dir results/ep-library-profile/
- Safety note:
--output-dir(and--work-dirif used) must live inside a dedicated workspace containing a.uht_tooling_workspacefile. This prevents accidental deletion of unrelated folders. Example:mkdir -p ~/uht_tooling_workspace touch ~/uht_tooling_workspace/.uht_tooling_workspace # then use --output-dir ~/uht_tooling_workspace/ep-library-profile/
Output structure
Each sample produces an organized output directory:
sample_name/
├── KEY_FINDINGS.txt # Lay-user executive summary
├── summary_panels.png # Main visualization (PNG)
├── summary_panels.pdf # Main visualization (PDF)
├── run.log # Analysis log
└── detailed/ # Technical outputs
├── gene_mismatch_rates.csv
├── base_distribution.csv
├── aa_substitutions.csv # Protein-coding regions only
├── plasmid_coverage.csv
├── aa_mutation_distribution.csv
├── summary.txt
└── {sample}_mutation_spectrum.pdf
A top-level master_summary.txt aggregates findings across all samples when multiple FASTQs are processed.
Lambda estimate
The profiler reports a single lambda (mutations per gene copy) derived from the net mismatch rate:
- Formula:
(hit_rate - bg_rate) × seq_len - Where it appears: panel 4 of
summary_panels.pngand the Poisson lambda line inKEY_FINDINGS.txt.
The KEY_FINDINGS.txt file provides a plain-language summary including:
- Expected AA mutations per gene copy
- Poisson-based interpretation (% wild-type, % 1 mutation, % 2+ mutations)
- Quality assessment (GOOD/ACCEPTABLE/LOW COVERAGE)
How the mutation rate and AA expectations are derived
- Reads are aligned to both the region of interest and the full plasmid. The profiler first locates the ROI on the circular plasmid, allowing forward, reverse-complement, and origin-spanning matches. Mismatches in the ROI define the "target" rate; mismatches elsewhere provide the background.
- The per-base background rate is subtracted from the target rate to yield a net nucleotide mutation rate, and the standard deviation reflects binomial sampling and quality-score uncertainty.
- The net rate is multiplied by the CDS length to estimate λ_bp (mutations per copy). Monte Carlo simulations then flip random bases, translate the mutated CDS, and count amino-acid differences across 1,000 trials—these drive the AA mutation mean/variance that appear in the panel plot and summary.
SSM profiler
- Inputs:
- ROI CDS FASTA
- Full plasmid FASTA
- FASTQ inputs (
--fastqaccepts multiple files) - One or more target amino-acid sites via repeated
--target-site - Optional per-site degenerate codon schemes via repeated
--site-scheme, e.g.45:NNK
- Run:
uht-tooling ssm-profiler \ --region-fasta data/ssm-profiler/roi_cds.fasta \ --plasmid-fasta data/ssm-profiler/plasmid.fasta \ --target-site 45 --target-site 46 --target-site 47 \ --site-scheme 45:NNK --site-scheme 46:NNK --site-scheme 47:NNW \ --fastq data/ssm-profiler/*.fastq.gz \ --output-dir results/ssm-profiler/
- Reports:
- Per-target-site codon-complete coverage and non-reference AA fraction
- Observed AA distributions at each target site
- Observed-vs-expected AA distributions when schemes are supplied
- Off-target mismatch rates elsewhere in the ROI, compared against plasmid background
- A target-site mutational-load summary that only counts the specified codons
GUI quick start (optional)
The NiceGUI web frontend wraps the same workflows with an Apple-inspired design and sidebar navigation. Launch it with:
uht-tooling gui
The server binds to http://127.0.0.1:7860 by default. Open that URL in your browser to access the interface.
Navigation
The sidebar organises workflows into two groups:
Primer Design
- Nextera XT (
/) - SLIM (
/slim) - KLD (
/kld) - Gibson (
/gibson)
Sequencing Analysis
- Mutation Caller (
/mutation-caller) - UMI Hunter (
/umi-hunter) - Profile Inserts (
/profile-inserts) - EP Library (
/ep-library) - SSM Profiler (
/ssm-profiler)
Features
- Dark mode toggle — persists across sessions via browser storage.
- FASTA paste support — Mutation Caller, UMI Hunter, and EP Library pages accept raw sequence paste in addition to file upload.
- Slider controls with live value display — UMI Hunter thresholds, Profile Inserts min-ratio.
- Download results as ZIP — output archives mirror the directory structure produced by the CLI.
Legacy Gradio interface
The old Gradio GUI is still available:
pip install "uht-tooling[legacy-gui]"
uht-tooling gui --legacy
Workflow tips
- For large FASTQ datasets, the CLI remains the most efficient option (especially for automation or batch processing).
Troubleshooting
- Port already bound: the launcher automatically selects the next free port and logs the chosen URL.
- Missing dependency: ensure you installed with
pip install "uht-tooling[gui]"(or the core package, which already includes NiceGUI). - Stopping the server: press
Ctrl+Cin the terminal session runninguht-tooling gui.
Logging
Every workflow configures logging to the destination output directory. Inspect run.log for command echoes, parameter choices, and any warnings produced during execution. When providing bug reports, include this log file along with input metadata to streamline triage.
Roadmap
- Expand CLI coverage to any remaining legacy scripts that are still invoked via
make. - Add documentation for automation pipelines and integrate continuous integration tests.
Contributions in the form of bug reports, pull requests, or feature suggestions are welcome. File issues on GitHub with clear reproduction steps and sample data when possible.
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file uht_tooling-0.6.0.tar.gz.
File metadata
- Download URL: uht_tooling-0.6.0.tar.gz
- Upload date:
- Size: 127.4 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.2.0 CPython/3.10.15
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
8957363893b57b95bef9478e664ec629a2c2419df3c3f7ba7da87356b9d8a203
|
|
| MD5 |
82ec7ba0ecf47a9cc2547dcffd7559a1
|
|
| BLAKE2b-256 |
46b585e3dc555bcfb500b1367945593b633580a4c309ab4844a026d8e6c0caa8
|
File details
Details for the file uht_tooling-0.6.0-py3-none-any.whl.
File metadata
- Download URL: uht_tooling-0.6.0-py3-none-any.whl
- Upload date:
- Size: 136.1 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.2.0 CPython/3.10.15
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
21cf96143501f94299ad62f2553ba72ed768515914e6ea4bdb03655d2a094bb3
|
|
| MD5 |
493efa6f9f02f1f7b20413dacc2f65bf
|
|
| BLAKE2b-256 |
be9cad9b989bd5bf36c76dd812fda064c4a33f7b01f6a5e1f1e195462ce202f2
|