Skip to main content

No project description provided

Project description

Python pakcage for genomic variant analysis

variant-effect command can infer the effect of a mutation

  • The input file has 4 columns: chromosome, position, reference allele, alternative allele. No header is required.

eg:

chr16   400560  G       T
chr17   41690930        G       T
chr6    61574496        A       T
chr2    84906522        G       T
chr2    216205243       G       T
chr4    73455665        G       T
chr2    101891316       G       T
chr2    69820761        G       T
chr6    30723661        A       T
  • The output can be stdout stdout, or a file.
#chrom  pos     ref     alt     mut_type        gene_name       transcript_id   transcript_pos  transcript_motif        coding_pos      codon_ref       aa_pos  aa_ref
chr16   400560  G       T       ThreePrimeUTR   NME4    ENST00000219479 806     GCACCAAAGTGCCGGACAACC   None    None    None    None
chr17   41690930        G       T       Substitution    EIF1    ENST00000591776 515     CTTGTATAATGTAACCATTTG   363     ATG     121     M
chr6    61574496        A       T       Intergenic      None    None    None    None    None    None    None    None                                                                                                                        chr2    84906522        G       T       ThreePrimeUTR   TMSB10  ENST00000233143 312     AAGCTGCACTGTGAACCTGGG   None    None    None    None
chr2    216205243       G       T       ThreePrimeUTR   XRCC5   ENST00000392133 2701    TGCCATCGCTGTGATGCTGGG   None    None    None    None
chr4    73455665        G       T       Substitution    AFP     ENST00000226359 1836    TTCATTCGGTGTGAACTTTTC   1820    TGT     607     C
chr2    101891316       G       T       ThreePrimeUTR   MAP4K4  ENST00000350878 4267    GGAATTCCTTGTAACTGGAGC   None    None    None    None
chr2    69820761        G       T       Substitution    ANXA4   ENST00000394295 934     AAATTGACATGTTGGATATCC   846     ATG     282     M
chr6    30723661        A       T       Substitution    TUBB    ENST00000327892 754     GATGAGACCTATTGCATTGAC   599     TAT     200     Y

Project details


Release history Release notifications | RSS feed

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

variant-0.0.5.tar.gz (3.5 kB view details)

Uploaded Source

Built Distribution

variant-0.0.5-py3-none-any.whl (3.8 kB view details)

Uploaded Python 3

File details

Details for the file variant-0.0.5.tar.gz.

File metadata

  • Download URL: variant-0.0.5.tar.gz
  • Upload date:
  • Size: 3.5 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: poetry/1.2.0a2 CPython/3.9.7 Linux/4.19.128-microsoft-standard

File hashes

Hashes for variant-0.0.5.tar.gz
Algorithm Hash digest
SHA256 ae726a230e3ecf0111fdc01de9615dfb7515989684f32b0cf24dd7976c68e244
MD5 e9af24b0bc479aa4da58687068bed43b
BLAKE2b-256 40e46c566a44b34b0ba632a4c2fccd7ba207d3de7cc792fee4c5eae5c8e91805

See more details on using hashes here.

File details

Details for the file variant-0.0.5-py3-none-any.whl.

File metadata

  • Download URL: variant-0.0.5-py3-none-any.whl
  • Upload date:
  • Size: 3.8 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: poetry/1.2.0a2 CPython/3.9.7 Linux/4.19.128-microsoft-standard

File hashes

Hashes for variant-0.0.5-py3-none-any.whl
Algorithm Hash digest
SHA256 aca8ba6fab811b2fc6d5bda0c242c59aab14c94f125917f11f411547bcf4a35e
MD5 3898d0fafbe4c378724fd472b71b0f1e
BLAKE2b-256 5614068632ff3a722ec1579a61dad505917cbe93f68f18509529cb6041f0e11f

See more details on using hashes here.

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page