No project description provided
Project description
Python pakcage for genomic variant analysis
variant-effect
command can infer the effect of a mutation
- The input file has 4 columns:
chromosome
,position
,reference allele
,alternative allele
. No header is required.
eg:
chr16 400560 G T
chr17 41690930 G T
chr6 61574496 A T
chr2 84906522 G T
chr2 216205243 G T
chr4 73455665 G T
chr2 101891316 G T
chr2 69820761 G T
chr6 30723661 A T
- The output can be stdout stdout, or a file.
#chrom pos ref alt mut_type gene_name transcript_id transcript_pos transcript_motif coding_pos codon_ref aa_pos aa_ref
chr16 400560 G T ThreePrimeUTR NME4 ENST00000219479 806 GCACCAAAGTGCCGGACAACC None None None None
chr17 41690930 G T Substitution EIF1 ENST00000591776 515 CTTGTATAATGTAACCATTTG 363 ATG 121 M
chr6 61574496 A T Intergenic None None None None None None None None chr2 84906522 G T ThreePrimeUTR TMSB10 ENST00000233143 312 AAGCTGCACTGTGAACCTGGG None None None None
chr2 216205243 G T ThreePrimeUTR XRCC5 ENST00000392133 2701 TGCCATCGCTGTGATGCTGGG None None None None
chr4 73455665 G T Substitution AFP ENST00000226359 1836 TTCATTCGGTGTGAACTTTTC 1820 TGT 607 C
chr2 101891316 G T ThreePrimeUTR MAP4K4 ENST00000350878 4267 GGAATTCCTTGTAACTGGAGC None None None None
chr2 69820761 G T Substitution ANXA4 ENST00000394295 934 AAATTGACATGTTGGATATCC 846 ATG 282 M
chr6 30723661 A T Substitution TUBB ENST00000327892 754 GATGAGACCTATTGCATTGAC 599 TAT 200 Y
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
variant-0.0.5.tar.gz
(3.5 kB
view details)
Built Distribution
File details
Details for the file variant-0.0.5.tar.gz
.
File metadata
- Download URL: variant-0.0.5.tar.gz
- Upload date:
- Size: 3.5 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: poetry/1.2.0a2 CPython/3.9.7 Linux/4.19.128-microsoft-standard
File hashes
Algorithm | Hash digest | |
---|---|---|
SHA256 | ae726a230e3ecf0111fdc01de9615dfb7515989684f32b0cf24dd7976c68e244 |
|
MD5 | e9af24b0bc479aa4da58687068bed43b |
|
BLAKE2b-256 | 40e46c566a44b34b0ba632a4c2fccd7ba207d3de7cc792fee4c5eae5c8e91805 |
File details
Details for the file variant-0.0.5-py3-none-any.whl
.
File metadata
- Download URL: variant-0.0.5-py3-none-any.whl
- Upload date:
- Size: 3.8 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: poetry/1.2.0a2 CPython/3.9.7 Linux/4.19.128-microsoft-standard
File hashes
Algorithm | Hash digest | |
---|---|---|
SHA256 | aca8ba6fab811b2fc6d5bda0c242c59aab14c94f125917f11f411547bcf4a35e |
|
MD5 | 3898d0fafbe4c378724fd472b71b0f1e |
|
BLAKE2b-256 | 5614068632ff3a722ec1579a61dad505917cbe93f68f18509529cb6041f0e11f |