No project description provided
Project description
Python pakcage for genomic variant analysis
variant-effect
command can infer the effect of a mutation
The input file has 5 columns: chromosome
, position
, strand
, reference allele
, alternative allele
.
- No header is required.
- The 3rd column (strand) is not used by default, just for compatibility with RNA mode.
- By default, the base of reference and alternative allele are based on DNA information
- For RNA mode (through
--rna
argument), the base of reference and alternative allele is reverse complement if the strand is negative(-).
eg:
chr16 400560 . G T
chr17 41690930 . G T
chr6 61574496 . A T
chr2 84906522 . G T
chr2 216205243 . G T
chr4 73455665 . G T
chr2 101891316 . G T
chr2 69820761 . G T
chr6 30723661 . A T
- The output can be stdout stdout, or a file.
#chrom pos strand ref alt mut_type gene_name transcript_id transcript_pos transcript_motif coding_pos codon_ref aa_pos aa_ref
chr16 400560 . G T ThreePrimeUTR NME4 ENST00000219479 806 GCACCAAAGTGCCGGACAACC None None None None
chr17 41690930 . G T Substitution EIF1 ENST00000591776 515 CTTGTATAATGTAACCATTTG 363 ATG 121 M
chr6 61574496 . A T Intergenic None None None None None None None None chr2 84906522 G T ThreePrimeUTR TMSB10 ENST00000233143 312 AAGCTGCACTGTGAACCTGGG None None None None
chr2 216205243 . G T ThreePrimeUTR XRCC5 ENST00000392133 2701 TGCCATCGCTGTGATGCTGGG None None None None
chr4 73455665 . G T Substitution AFP ENST00000226359 1836 TTCATTCGGTGTGAACTTTTC 1820 TGT 607 C
chr2 101891316 . G T ThreePrimeUTR MAP4K4 ENST00000350878 4267 GGAATTCCTTGTAACTGGAGC None None None None
chr2 69820761 . G T Substitution ANXA4 ENST00000394295 934 AAATTGACATGTTGGATATCC 846 ATG 282 M
chr6 30723661 . A T Substitution TUBB ENST00000327892 754 GATGAGACCTATTGCATTGAC 599 TAT 200 Y
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
variant-0.0.6.tar.gz
(4.2 kB
view hashes)