variant 0.0.76

No project description provided

Python pakcage for genomic variant analysis

How to use?

pip install variant

🧬 variant motif subcommand can fetch motif sequence around given site.

 Usage: variant motif [OPTIONS]                                                                           
                                                                                                          
 Fetch genomic motif.                                                                                     
                                                                                                          
╭─ Options ─────────────────────────────────────────────────────────────────╮
│    --input        -i  TEXT  Input position file.                          │
│    --output       -o  TEXT  Output annotation file.                       │
│ *  --fasta        -f  TEXT  reference fasta file. [required]              │
│    --npad         -n  TEXT  Number of padding base to call motif. If you  │
│                             want to set different left and right pads,    │
│                             use comma to separate them. (eg. 2,3)         │
│    --with-header  -H        With header line in input file.               │
│    --columns      -c  TEXT  Sets columns for site info.                   │
│                             (Chrom,Pos,Strand)                            │
│                             [default: 1,2,3]                              │
│    --to-upper     -u        Convert motif to upper case.                  │
│    --wrap-site    -w        Wrap motif site.                              │
│    --help         -h        Show this message and exit.                   │
╰───────────────────────────────────────────────────────────────────────────╯

demo:

I would like to get the 2 bases before the given sites, and 3 bases after the given sites, meanwhile, wrap the give sites with bracket. Moreover, the strand information should be taken into account.

use -n 2,3 -w

🧫 variant effect subcommand can infer the effect of a mutation

 Usage: variant effect [OPTIONS]                                                                          
                                                                                                          
 Annotation genomic variant effect.                                                                       
                                                                                                          
╭─ Options ─────────────────────────────────────────────────────────────────╮
│ --input                 -i  TEXT     Input position file.                 │
│ --output                -o  TEXT     Output annotation file               │
│ --reference             -r  TEXT     reference species                    │
│ --reference-gtf             TEXT     Customized reference gtf file.       │
│ --reference-transcript      TEXT     Customized reference transcript      │
│                                      fasta file.                          │
│ --reference-protein         TEXT     Customized reference protein fasta   │
│                                      file.                                │
│ --reference-mapping         TEXT     Mapping file for chrom name, first   │
│                                      column is chrom in the input, second │
│                                      column is chrom in the reference db  │
│                                      (sep by tab)                         │
│ --release               -e  INTEGER  ensembl release                      │
│ --strandness            -s           Use strand infomation or not?        │
│ --pU-mode               -u           Make rRNA, tRNA, snoRNA into top     │
│                                      priority.                            │
│ --npad                  -n  INTEGER  Number of padding base to call       │
│                                      motif.                               │
│ --all-effects           -a           Output all effects.                  │
│ --with-header           -H           With header line in input file.      │
│ --columns               -c  TEXT     Sets columns for site info.          │
│                                      (Chrom,Pos,Strand,Ref,Alt)           │
│                                      [default: 1,2,3,4,5]                 │
│ --help                  -h           Show this message and exit.          │
╰───────────────────────────────────────────────────────────────────────────╯

demo:

Store the following table in file (sites.tsv).

Chrom	Position	Strand	Ref	Alt
chr1	230703034	-	C	T
chr12	69353439	+	A	T
chr14	23645352	+	G	T
chr2	215361150	-	A	T
chr2	84906537	+	C	T
chr22	39319077	-	T	A
chr22	39319095	-	T	A
chr22	39319098	-	T	A

Run command:

variant-effect -i sites.tsv -H -r human -e 108 -t RNA -H -c 1,2,3

• -i specify the input file
• -H means the file is with header line, and the first row will be skipped;
• -r use the specific genome, default is human
• -e specify the Ensembl release version
• -c means only use some of the columns in the input file. default will use the first 5 columns.

You will have this output

Chrom	Position	Strand	Ref	Alt	mut_type	gene_type	gene_name	gene_pos	transcript_name	transcript_pos	transcript_motif	coding_pos	codon_ref	aa_pos	aa_ref	distance2splice
chr1	230703034	-	C	T	ThreePrimeUTR	protein_coding	ENSG00000135744(AGT)	42543	ENST00000680041(AGT-208)	1753	TGTGTCACCCCCAGTCTCCCA	None	None	None	None	295
chr12	69353439	+	A	T	ThreePrimeUTR	protein_coding	ENSG00000090382(LYZ)	5059	ENST00000261267(LYZ-201)	695	TAGAACTAATACTGGTGAAAA	None	None	None	None	286
chr14	23645352	+	G	T	ThreePrimeUTR	protein_coding	ENSG00000100867(DHRS2)	15238	ENST00000344777(DHRS2-202)	1391	CTGCCATTCTGCCAGACTAGC	None	None	None	None	210
chr2	215361150	-	A	T	ThreePrimeUTR	protein_coding	ENSG00000115414(FN1)	74924	ENST00000323926(FN1-201)	8012	GGCCCGCAATACTGTAGGAAC	None	None	None	None	476
chr2	84906537	+	C	T	ThreePrimeUTR	protein_coding	ENSG00000034510(TMSB10)	882	ENST00000233143(TMSB10-201)	327	CCTGGGCACTCCGCGCCGATG	None	None	None	None	148
chr22	39319077	-	T	A	Intronic	protein_coding	ENSG00000100316(RPL3)	1313	ENST00000216146(RPL3-201)	None	None	None	None	None	None	None
chr22	39319095	-	T	A	Intronic	protein_coding	ENSG00000100316(RPL3)	1295	ENST00000216146(RPL3-201)	None	None	None	None	None	None	None
chr22	39319098	-	T	A	Intronic	protein_coding	ENSG00000100316(RPL3)	1292	ENST00000216146(RPL3-201)	None	None	None	None	None	None	None

⏳⏳⏳ more functions will be supported in the future

TODO:

• imporve speed. Base on cgranges, pyranges?, or BioCantor?