webblast
Fast NCBI BLAST searches from the command line. webblast submits
nucleotide / protein queries to NCBI BLAST through the same interactive path
the website uses (a real NCBI session + browser User-Agent + the full web
parameter set), then polls early and adaptively — so a typical search is
done in a few seconds, not the ~30s that NCBI's conservative RTOE estimate
suggests.
It parses the compact JSON2_S report (instead of multi-megabyte HTML) into
clean, machine-readable records.
Install
pip install webblast
Quick start
# search a FASTA file against nt with megablast (default)
webblast -p megablast -d nt query.fa
# TSV output, limit to 50 target sequences
webblast -d nt -f tsv --max-num-seq 50 query.fa
# protein search
webblast -p blastp -d nr protein.fa
# read a pasted FASTA from stdin
echo '>seq
AGTCAAAACCACAATGAGATACCATCTCATGTCAGTCAGAATGGCTATTACTAAAAA' | webblast --limit 1
Runs as a Python library too:
from webblast import BlastClient, parse_blast_json
client = BlastClient(program="megablast", database="nt", email="you@example.org")
report = client.run(">seq\nACGTACGTACGT", format_type="JSON2_S")
parsed = parse_blast_json(report)
print(parsed.program, parsed.version, parsed.total_hits)
Why it's fast
- Interactive web queue. NCBI gives priority to interactive (website) users
and deprioritizes automated API traffic.
BlastClientreproduces the browser's submission — session cookie, browser User-Agent, and web parameters (PAGE,BLAST_PROGRAMS,MEGABLAST=on, ...) — so jobs land on the fast queue. - Don't sleep the RTOE. NCBI returns a very conservative
RTOE(often ~30s) that is a poor estimate for short queries, which usually finish in 3–10s.webblastpolls early and backs off geometrically, catching the result as soon as it's ready. - Compact JSON. Results are read back as
JSON2_S(hundreds of KB, not multi-megabyte HTML), so parsing is light.
Output formats
--format |
Description |
|---|---|
text (default) |
Rich terminal table: accession, description, E-value, %identity, alignment length, bit score, 中文名 |
tsv |
Clean tab-delimited rows (query, accession, title, evalue, pident, align_len, bitscore, zh) |
json |
Compact JSON with per-query/hit/hsp fields (+ zh / sciname) |
fasta |
Subject segments of the top HSP per hit (pseudo-FASTA) |
中文名 (Chinese species names)
Each hit gets its Chinese common name from a bundled dictionary
(webblast/data/species.zh.pkl.xz, lzma-compressed) covering ~489,000 species.
It's loaded lazily (once) and looked up in O(1), so it's offline, deterministic
and fast — no model, no network calls at runtime.
--no-translatedisables the 中文名 column (it's on by default).
To grow the dictionary, drop extra scientific_name<TAB>中文名 rows into a file
and point webblast at it via the WEBLAST_SPECIES_TSV env var (or
~/.config/webblast/species.tsv); those rows override the bundled ones.
Options
-p, --program megablast (default), discontiguous-megablast, blastn, blastp,
quickblastp, blastx, tblastn, tblastx, rpsblast
-d, --database nt (default), nr, refseq_rna, refseq_protein, swissprot, ...
-o, --out FILE write output to a file
--max-num-seq N max target sequences per query (default 100)
--expect E E-value cutoff (e.g. 1e-5)
--email ADDR contact email (NCBI usage policy)
--api-key KEY NCBI API key (raises rate limit)
--cache/--no-cache on-disk result cache (default on)
--limit N only use the first N query records
--wait-timeout S max wait for the search (default 1200s)
Caching
Identical searches (keyed on program + database + options + query) are cached on
disk under blast_cache/, so re-running the same query is instant.
Input formats
FASTA / FASTQ / (optionally) BAM/SAM via pysam (pip install webblast[bam]),
from files or stdin.
Notes & fair use
- NCBI is a shared resource. Keep submissions modest, use
--email, and consider off-peak hours for large batches. - Running tens of thousands of searches is better served by a local/cloud BLAST install (the URL API only suits small, occasional jobs).
Development
pip install -e .[dev]
pytest
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file webblast-0.0.10.tar.gz.
File metadata
- Download URL: webblast-0.0.10.tar.gz
- Upload date:
- Size: 4.7 MB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/6.2.0 CPython/3.9.25
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
fa174c80c89803bed528374a31a649630c7570b251b3b2f9699b691ab6dfa4e4
|
|
| MD5 |
4545b774abd80fa2fab90437f0378bb7
|
|
| BLAKE2b-256 |
3686021e88bbd6c68433ef7c4754dbb890f27f6a56e525c18409655905c02bdb
|
File details
Details for the file webblast-0.0.10-py3-none-any.whl.
File metadata
- Download URL: webblast-0.0.10-py3-none-any.whl
- Upload date:
- Size: 4.7 MB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/6.2.0 CPython/3.9.25
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
6ae802cca0caff21e1b54507d29fac4a07c1a902dd574f4e6c5004c862ff5a0b
|
|
| MD5 |
e8318c8c61c19be0651f0accffde26d5
|
|
| BLAKE2b-256 |
49d9fa7f562ef27d9969e7a75d7f50cd8a1460d39268832a5ec129dc7d6ede4d
|