detect mutation in gene and its location
Project description
Gene Mutation Detection Package
The Gene Mutation Detection Package is a Python library that allows you to analyze DNA sequences and identify mutations. It provides information about the position of the mutation and prints the mutated region.
Installation:
You can install the package using pip: pip install gene-mutation-detection
Usage:
- Import the detectMutation function from the package:
from gene_mutation_detection import detectMutation
- Provide the paths to your original and mutant DNA sequence files
original_fasta_file = 'C:/Users/Dell/Downloads/HEXA_datasets/ncbi_dataset/data/gene.fna'
mutant_fasta_file = 'C:/Users/Dell/Downloads/HEXA_datasets/ncbi_dataset/data/gene-mut.fna'
- Call the detectMutation function:
mutation_detection_result = detectMutation(original_fasta_file, mutant_fasta_file) print(mutation_detection_result)
Note: you can provide path to original and mutant DNA sequence files in the function directly
Example Output:
If a mutation is detected, the output will be similar to:
Mutation detected in gene NC_000015.10:c72376014-72340924 at position 10920. Mutated region: AAAAAGAGTATTTTTTTTTT
If no mutation is found, it will display:
No mutation detecteted.
Project details
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file zeny_mut-0.0.5.tar.gz.
File metadata
- Download URL: zeny_mut-0.0.5.tar.gz
- Upload date:
- Size: 3.0 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/5.1.0 CPython/3.10.10
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
dc7ffc51485b2a02ee9fffd20412a986b34366ffdf72eca709b2a0411c5f0000
|
|
| MD5 |
2a01e0463cf39260a76563cbc72651f2
|
|
| BLAKE2b-256 |
1e0837615726936bc2d93bd0c80b975c427d2a3c1995ce81a0bf71ab8e0bc316
|
File details
Details for the file zeny_mut-0.0.5-py3-none-any.whl.
File metadata
- Download URL: zeny_mut-0.0.5-py3-none-any.whl
- Upload date:
- Size: 3.7 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/5.1.0 CPython/3.10.10
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
01eba73eda0ed3aa6375928a827c813dcbc435f6e675b1e1b08bdc406419cb4c
|
|
| MD5 |
6ec7b0ad9ec19c6987fa45a6ff0fd78c
|
|
| BLAKE2b-256 |
ed28c1cbcfd5e3e6356dd755f2c10dd2a1ad15168edcece303618aff8c0f247b
|