Python pakcage for genomic variant analysis
How to install?
pip install variant
How to use?
🧬 variant motif subcommand can fetch motif sequence around given site.
Usage: variant motif [OPTIONS]
Fetch genomic motif.
╭─ Options ─────────────────────────────────────────────────────────────────╮
│ --input -i TEXT Input position file. │
│ --output -o TEXT Output annotation file. │
│ * --fasta -f TEXT reference fasta file. [required] │
│ --npad -n TEXT Number of padding base to call motif. If you │
│ want to set different left and right pads, │
│ use comma to separate them. (eg. 2,3) │
│ --padding -p TEXT Padding base to use for motif. 'N' by default │
│ but can be set to any single letter │
│ --with-header -H With header line in input file. │
│ --columns -c TEXT Sets columns for site info. │
│ (Chrom,Pos,Strand) │
│ [default: 1,2,3] │
│ --to-upper -u Convert motif to upper case. │
│ --wrap-site -w Wrap motif site. │
│ --help -h Show this message and exit. │
╰───────────────────────────────────────────────────────────────────────────╯
demo:
I would like to get the 2 bases before the given sites, and 3 bases after the given sites, meanwhile, wrap the give sites with bracket. Moreover, the strand information should be taken into account.
use -n 2,3 -w
🧫 variant effect subcommand can infer the effect of a mutation
Usage: variant effect [OPTIONS]
Annotation genomic variant effect.
╭─ Options ────────────────────────────────────────────────────────────────╮
│ --input -i TEXT Input position file. │
│ --output -o TEXT Output annotation file │
│ --reference -r TEXT reference species │
│ --reference-gtf TEXT Customized reference gtf file. │
│ --reference-transcript TEXT Customized reference transcript │
│ fasta file. │
│ --reference-protein TEXT Customized reference protein fasta │
│ file. │
│ --release -e INTEGER ensembl release │
│ --strandness -s Use strand infomation or not? │
│ --pU-mode -u Make rRNA, tRNA, snoRNA into top │
│ priority. │
│ --npad -n INTEGER Number of padding base to call │
│ motif. │
│ --all-effects -a Output all effects. │
│ --with-header -H With header line in input file. │
│ --columns -c TEXT Sets columns for site info. │
│ (Chrom,Pos,Strand,Ref,Alt) │
│ [default: 1,2,3,4,5] │
│ --help -h Show this message and exit. │
╰──────────────────────────────────────────────────────────────────────────╯
demo:
Store the following table in file (sites.tsv).
| Chrom | Position | Strand | Ref | Alt |
|---|---|---|---|---|
| chr1 | 230703034 | - | C | T |
| chr12 | 69353439 | + | A | T |
| chr14 | 23645352 | + | G | T |
| chr2 | 215361150 | - | A | T |
| chr2 | 84906537 | + | C | T |
| chr22 | 39319077 | - | T | A |
| chr22 | 39319095 | - | T | A |
| chr22 | 39319098 | - | T | A |
Run command:
variant-effect -i sites.tsv -H -r human -e 108 -t RNA -H -c 1,2,3
-ispecify the input file-Hmeans the file is with header line, and the first row will be skipped;-ruse the specific genome, default is human-especify the Ensembl release version-cmeans only use some of the columns in the input file. default will use the first 5 columns.
You will have this output
| Chrom | Position | Strand | Ref | Alt | mut_type | gene_type | gene_name | gene_pos | transcript_name | transcript_pos | transcript_motif | coding_pos | codon_ref | aa_pos | aa_ref | distance2splice |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| chr1 | 230703034 | - | C | T | ThreePrimeUTR | protein_coding | ENSG00000135744(AGT) | 42543 | ENST00000680041(AGT-208) | 1753 | TGTGTCACCCCCAGTCTCCCA | None | None | None | None | 295 |
| chr12 | 69353439 | + | A | T | ThreePrimeUTR | protein_coding | ENSG00000090382(LYZ) | 5059 | ENST00000261267(LYZ-201) | 695 | TAGAACTAATACTGGTGAAAA | None | None | None | None | 286 |
| chr14 | 23645352 | + | G | T | ThreePrimeUTR | protein_coding | ENSG00000100867(DHRS2) | 15238 | ENST00000344777(DHRS2-202) | 1391 | CTGCCATTCTGCCAGACTAGC | None | None | None | None | 210 |
| chr2 | 215361150 | - | A | T | ThreePrimeUTR | protein_coding | ENSG00000115414(FN1) | 74924 | ENST00000323926(FN1-201) | 8012 | GGCCCGCAATACTGTAGGAAC | None | None | None | None | 476 |
| chr2 | 84906537 | + | C | T | ThreePrimeUTR | protein_coding | ENSG00000034510(TMSB10) | 882 | ENST00000233143(TMSB10-201) | 327 | CCTGGGCACTCCGCGCCGATG | None | None | None | None | 148 |
| chr22 | 39319077 | - | T | A | Intronic | protein_coding | ENSG00000100316(RPL3) | 1313 | ENST00000216146(RPL3-201) | None | None | None | None | None | None | None |
| chr22 | 39319095 | - | T | A | Intronic | protein_coding | ENSG00000100316(RPL3) | 1295 | ENST00000216146(RPL3-201) | None | None | None | None | None | None | None |
| chr22 | 39319098 | - | T | A | Intronic | protein_coding | ENSG00000100316(RPL3) | 1292 | ENST00000216146(RPL3-201) | None | None | None | None | None | None | None |
🧫 variant coordinate subcommand can mapping chrom name and positions between different reference coordinate
Usage: variant coordinate [OPTIONS]
Fetch genomic motif.
╭─ Options ───────────────────────────────────────────────────────────────────╮
│ --input -i TEXT Input position file. │
│ --output -o TEXT Output annotation file. │
│ --reference-mapping -m TEXT Mapping file for chrom name, first column is │
│ chrom in the input, second column is chrom │
│ in the reference db (sep by tab) │
│ --buildin-mapping -M TEXT Build-in mapping for chrom name: U2E (UCSC │
│ to Ensembl), E2U (Ensembl to UCSC) │
│ --with-header -H With header line in input file. │
│ --columns -c TEXT Sets columns for site info. (Chrom) │
│ [default: 1] │
│ --help -h Show this message and exit. │
╰─────────────────────────────────────────────────────────────────────────────╯
⏳⏳⏳ more functions will be supported in the future
TODO:
1 maintainer
Metadata
1 maintainer
Release files for variant 0.0.98
For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.
Source distribution (sdist)
| File | Size | Uploaded | Provenance | |
|---|---|---|---|---|
| variant-0.0.98.tar.gz | 17.5 kB | With provenance | Details |
Built distributions (wheels)
Total release size: 389.6 kB
Release files / variant-0.0.98.tar.gz
| Download URL | variant-0.0.98.tar.gz |
|---|---|
| Size | 17.5 kB |
| Tags | Source |
|
SHA-256 checksum How to use checksums |
d7e05eab370eb0f824cdec11df39cc7221c0b209b4f3935cc21d018dbd299667
|
|
BLAKE2b-256 checksum How to use checksums |
939abf4f59c3ef0289980698d24d17b87a612867eacba10a7e238d5c229e89ef
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.12.9
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 5, 2025.
Transparency logRelease files / variant-0.0.98-cp313-cp313-musllinux_1_2_x86_64.whl
| Download URL | variant-0.0.98-cp313-cp313-musllinux_1_2_x86_64.whl |
|---|---|
| Size | 26.0 kB |
| Tags | CPython 3.13 Linux musl 1.2+ x86-64 |
|
SHA-256 checksum How to use checksums |
1edabe30bfbd89d639efa9b62c2c50d7c109e665a1b8077c2a122b90ece3fb72
|
|
BLAKE2b-256 checksum How to use checksums |
aa539408d871e1849fe91c76a3e6f0027fba38d61d120f811e3b52f32eb05d23
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.12.9
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 5, 2025.
Transparency logRelease files / variant-0.0.98-cp313-cp313-musllinux_1_2_i686.whl
| Download URL | variant-0.0.98-cp313-cp313-musllinux_1_2_i686.whl |
|---|---|
| Size | 26.1 kB |
| Tags | CPython 3.13 Linux musl 1.2+ x86-32 |
|
SHA-256 checksum How to use checksums |
3757438af7664490bab32d756bca4719106fcf4048c01046e4b319630d430383
|
|
BLAKE2b-256 checksum How to use checksums |
687b8859782bbd2ecc4f54ba799c83ef1cf0e097210f28019bbf69a34e9f94bf
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.12.9
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 5, 2025.
Transparency logRelease files / variant-0.0.98-cp313-cp313-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl
| Download URL | variant-0.0.98-cp313-cp313-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl |
|---|---|
| Size | 25.9 kB |
| Tags | CPython 3.13 Linux glibc 2.17+ x86-64 Linux glibc 2.5+ x86-64 |
|
SHA-256 checksum How to use checksums |
8050b3085d91407bb2234a4df4a19ea5546cad980c9387651ed5b79553e6d29e
|
|
BLAKE2b-256 checksum How to use checksums |
d6a70440afe8024a4e2d8656ee7604455b6bf33555aaf951878bbf9490442478
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.12.9
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 5, 2025.
Transparency logRelease files / variant-0.0.98-cp313-cp313-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl
| Download URL | variant-0.0.98-cp313-cp313-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl |
|---|---|
| Size | 25.8 kB |
| Tags | CPython 3.13 Linux glibc 2.17+ x86-32 Linux glibc 2.5+ x86-32 |
|
SHA-256 checksum How to use checksums |
eca2f3475039343471456d1d10b738b7830ac20cc55577a1ba9279be923f515e
|
|
BLAKE2b-256 checksum How to use checksums |
59bafc3a0c93bc4dfa0ea34bd02041d28846f16ba263562d218547fe5d487474
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.12.9
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 5, 2025.
Transparency logRelease files / variant-0.0.98-cp313-cp313-macosx_11_0_arm64.whl
| Download URL | variant-0.0.98-cp313-cp313-macosx_11_0_arm64.whl |
|---|---|
| Size | 20.4 kB |
| Tags | CPython 3.13 macOS 11.0+ ARM64 |
|
SHA-256 checksum How to use checksums |
0551a420d02238c6b2f5c82c94a45aa71f0584c8959a586137c9b6e9cb2573e6
|
|
BLAKE2b-256 checksum How to use checksums |
b20850345e249a66948a45bae7b0b3d3e8b307afb52c6a650e4299ce0906ea53
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.12.9
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 5, 2025.
Transparency logRelease files / variant-0.0.98-cp312-cp312-musllinux_1_2_x86_64.whl
| Download URL | variant-0.0.98-cp312-cp312-musllinux_1_2_x86_64.whl |
|---|---|
| Size | 26.0 kB |
| Tags | CPython 3.12 Linux musl 1.2+ x86-64 |
|
SHA-256 checksum How to use checksums |
d67fad8132756fbb0d8ffc15969e83d6489bb67b5492b943616b62b05debc493
|
|
BLAKE2b-256 checksum How to use checksums |
bfe225ee40cb0d0488e31cebac4c19174ccbe8d9afd236f9089ce8f5bfdf2d72
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.12.9
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 5, 2025.
Transparency logRelease files / variant-0.0.98-cp312-cp312-musllinux_1_2_i686.whl
| Download URL | variant-0.0.98-cp312-cp312-musllinux_1_2_i686.whl |
|---|---|
| Size | 26.0 kB |
| Tags | CPython 3.12 Linux musl 1.2+ x86-32 |
|
SHA-256 checksum How to use checksums |
9e4071a573b76eb7360626c82d77cfaf6f81065afda0c46a68ad0d35f5f5c667
|
|
BLAKE2b-256 checksum How to use checksums |
a4bdfeb486920243cb7b6f61d4d86f53ae0706fcbe98f81db12ef8b22b2c86a9
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.12.9
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 5, 2025.
Transparency logRelease files / variant-0.0.98-cp312-cp312-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl
| Download URL | variant-0.0.98-cp312-cp312-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl |
|---|---|
| Size | 26.0 kB |
| Tags | CPython 3.12 Linux glibc 2.17+ x86-64 Linux glibc 2.5+ x86-64 |
|
SHA-256 checksum How to use checksums |
f6cbefee7caeb140f9369a4971b86dccd023f4490e967f2033708f916722d361
|
|
BLAKE2b-256 checksum How to use checksums |
0a969c742cee93d61df0cc0673121ca1f40c04a0d28c8d17490b7c29306ba2a3
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.12.9
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 5, 2025.
Transparency logRelease files / variant-0.0.98-cp312-cp312-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl
| Download URL | variant-0.0.98-cp312-cp312-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl |
|---|---|
| Size | 25.8 kB |
| Tags | CPython 3.12 Linux glibc 2.17+ x86-32 Linux glibc 2.5+ x86-32 |
|
SHA-256 checksum How to use checksums |
3d3e3d451c4608f39e70947d348f5c50c540e51ff24223d69abbf557a2bc7dd1
|
|
BLAKE2b-256 checksum How to use checksums |
c76b2916afd65cb37117a6350b45353989d8885dabb3989ce96220c7871cd8e2
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.12.9
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 5, 2025.
Transparency logRelease files / variant-0.0.98-cp312-cp312-macosx_11_0_arm64.whl
| Download URL | variant-0.0.98-cp312-cp312-macosx_11_0_arm64.whl |
|---|---|
| Size | 20.4 kB |
| Tags | CPython 3.12 macOS 11.0+ ARM64 |
|
SHA-256 checksum How to use checksums |
45f14618f58f16d54c2d5e9c7e35e2c04709cc38dffe1673b67dba0bebd27203
|
|
BLAKE2b-256 checksum How to use checksums |
5234587ec5a1d4fa302b3dd51a341565a4195a61d241a40471240df0c98208da
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.12.9
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 5, 2025.
Transparency logRelease files / variant-0.0.98-cp311-cp311-musllinux_1_2_x86_64.whl
| Download URL | variant-0.0.98-cp311-cp311-musllinux_1_2_x86_64.whl |
|---|---|
| Size | 25.9 kB |
| Tags | CPython 3.11 Linux musl 1.2+ x86-64 |
|
SHA-256 checksum How to use checksums |
e8fb8384db090aec749c59bff3c5f1a86d8c417386b051b6dbd808eeb16a95ee
|
|
BLAKE2b-256 checksum How to use checksums |
8eaea6e99a88302ba1d3b56110aeee8ed8acea2336d49235e9d49cb7023b9369
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.12.9
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 5, 2025.
Transparency logRelease files / variant-0.0.98-cp311-cp311-musllinux_1_2_i686.whl
| Download URL | variant-0.0.98-cp311-cp311-musllinux_1_2_i686.whl |
|---|---|
| Size | 25.9 kB |
| Tags | CPython 3.11 Linux musl 1.2+ x86-32 |
|
SHA-256 checksum How to use checksums |
7a8edd9d29beebcf240a76d898f8622af7b93d89ced818098a4ce810251c940d
|
|
BLAKE2b-256 checksum How to use checksums |
aaab8cadc93132c51f44e68130f4e6d5643a72de99e28afee7e97058970f517c
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.12.9
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 5, 2025.
Transparency logRelease files / variant-0.0.98-cp311-cp311-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl
| Download URL | variant-0.0.98-cp311-cp311-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl |
|---|---|
| Size | 25.8 kB |
| Tags | CPython 3.11 Linux glibc 2.17+ x86-64 Linux glibc 2.5+ x86-64 |
|
SHA-256 checksum How to use checksums |
6e268d7736b339d2cea142ea55b54d6f8e09d13217493afeea3c28df0237ac91
|
|
BLAKE2b-256 checksum How to use checksums |
8902ac9012057d2048de82155fc3633e2fc0efc9395a7d2b4bdba450c9117875
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.12.9
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 5, 2025.
Transparency logRelease files / variant-0.0.98-cp311-cp311-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl
| Download URL | variant-0.0.98-cp311-cp311-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl |
|---|---|
| Size | 25.7 kB |
| Tags | CPython 3.11 Linux glibc 2.17+ x86-32 Linux glibc 2.5+ x86-32 |
|
SHA-256 checksum How to use checksums |
b9875255c8cedde7f74f7782e2cd006595d3a58c01755d34212bcae35be0c17b
|
|
BLAKE2b-256 checksum How to use checksums |
c8264c269b25f97201786e38a7ed56bb1faa98b50d0025a8ea025169f6263948
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.12.9
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 5, 2025.
Transparency logRelease files / variant-0.0.98-cp311-cp311-macosx_11_0_arm64.whl
| Download URL | variant-0.0.98-cp311-cp311-macosx_11_0_arm64.whl |
|---|---|
| Size | 20.4 kB |
| Tags | CPython 3.11 macOS 11.0+ ARM64 |
|
SHA-256 checksum How to use checksums |
26c065988a5f9a6fab78f07c1675f93a9a4b4bc90d15140192055569bc6daa5c
|
|
BLAKE2b-256 checksum How to use checksums |
961b620ebc695ce622490be6fd473b491a9093e55cd9bf4b969dec42fb8bcafb
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.12.9
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 5, 2025.
Transparency logSecurity for variant 0.0.98
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
Full provenance
All 16 files in this release have been uploaded with provenance metadata.
Attestation for variant-0.0.98.tar.gz
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 5, 2025.
Transparency logA note on package security
PyPI is a repository for distributing packages, not a service for auditing them. While third-party security researchers and our staff do their best to detect and remove malicious packages, PyPI cannot guarantee the quality, security or suitability of any given package.
To learn more about protecting yourself from malicious actors, visit our package security documentation.
