This is a pre-production deployment of Warehouse. Changes made here affect the production instance of PyPI (pypi.python.org).
Help us improve Python packaging - Donate today!
Project Description

Atropos

Atropos is tool for specific, sensitive, and speedy trimming of NGS reads. It is a fork of the venerable Cutadapt read trimmer (https://github.com/marcelm/cutadapt, DOI:10.14806/ej.17.1.200), with the primary improvements being:

  1. Multi-threading support, including an extremely fast “parallel write” mode.
  2. Implementation of a new insert alignment-based trimming algorithm for paired-end reads that is substantially more sensitive and specific than the original Cutadapt adapter alignment-based algorithm. This algorithm can also correct mismatches between the overlapping portions of the reads.
  3. Options for trimming specific types of data (miRNA, bisulfite-seq).
  4. A new command (‘detect’) that will detect adapter sequences and other potential contaminants.
  5. A new command (‘error’) that will estimate the sequencing error rate, which helps to select the appropriate adapter- and quality- trimming parameter values.
  6. A new command (‘qc’) that generates read statistics similar to FastQC. The trim command can also compute read statistics both before and after trimming (using the ‘–stats’ option).
  7. Improved summary reports, including support for serialization formats (JSON, YAML, pickle), support for user-defined templates (via the optional Jinja2 dependency), and integration with MultiQC.
  8. The ability to merge overlapping reads (this is experimental and the functionality is limited).
  9. The ability to write the summary report and log messages to separate files.
  10. The ability to read SAM/BAM files and read/write interleaved FASTQ files.
  11. A progress bar, and other minor usability enhancements.

Manual installation

Atropos is available from pypi and can be installed using pip.

First install dependencies:

  • Required
    • Python 3.3+ (python 2.x is NOT supported) - note: we have identified a possible bug in python 3.4.2 that causes random segmentation faults. We think this mainly affects unit testing (and thus specifically test on 3.4.3). If you encounter this bug, we recommend upgrading to a newer python version.
    • Cython 0.25.2+ (pip install Cython)
  • Optional
    • pytest (for running unit tests)
    • progressbar2 or tqdm (progressbar support)
    • pysam (SAM/BAM input)
    • khmer 2.0+ (pip install khmer) (for detecting low-frequency adapter contamination)
    • jinja2 (for user-defined report formats)

Then run:

pip install atropos

Conda

There is an Atropos recipe in Bioconda.

conda install -c bioconda atropos

Docker

A Docker image is available for Atropos in Docker Hub.

docker run jdidion/atropos <arguments>

Usage

Atropos is almost fully backward-compatible with cutadapt. If you currently use cutadapt, you can simply install Atropos and then substitute the executable name in your command line, with one key difference: you need to use options to specify input file names. For example:

atropos -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTTA -o trimmed.fq.gz -se reads.fq.gz

To take advantage of multi-threading, set the --threads option:

atropos --threads 8 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTTA -o trimmed.fq.gz -se reads.fq.gz

To take advantage of the new aligner (if you have paired-end reads with 3’ adatpers), set the --aligner option to ‘insert’:

atropos --aligner insert -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG \
  -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o trimmed.1.fq.gz -p trimmed.2.fq.gz \
  -pe1 reads.1.fq.gz -pe2 reads.2.fq.gz

See the Documentation for more complete usage information.

Publication

A preprint is available and the submitted paper is currently under review. The results in the paper can be fully reproduced using the workflow defined in the paper directory.

Developers

We welcome any contributions via GitHub issues and pull requests. See the documentation for style guidelines and best practices. We enforce the Contributor Covenant code of conduct.

Roadmap

1.2

  • Migrate to xphyle (https://github.com/jdidion/xphyle) for file management.
  • Provide option for RNA-seq data that will trim polyA sequence.
  • Accept multiple input files.
  • Support SAM output.
  • Expand the list of contaminants that are detected by default.
  • Accessibility:
    • Create recipe for homebrew.
    • Automatically update conda and homebrew recipes for each release.
    • Create Galaxy tool description using argparse2tool.

1.3

  • Provide PacBio- and nanopore-specific options (https://github.com/marcelm/cutadapt/issues/120).
  • Currently, InsertAligner requires a single 3’ adapter for each end. Adapter trimming will later be generalized so that A) the InsertAligner can handle multiple matched pairs of adapters and/or B) multiple different aligners can be used for different adapters.
  • Automate creation and sending of user statistics and crash reports using pytattle.

1.4

1.5

  • Provide more user control over anchoring of adapters: https://github.com/marcelm/cutadapt/issues/53.
  • Support for paired-end demultiplexing (i.e. when barcodes are used in both paired-end adapters): https://github.com/marcelm/cutadapt/issues/118.
  • Add option to estimate bisulfite conversion rate from filled-in cytosine methylation status in reads that were MspI-digested.
  • Consider supporting different error rates for read1 vs read2.
  • Add a ClipOverlapping modifier that will remove read overlaps (as opposed to merging).
  • Add option to InsertAdapter to trim overhangs without adapter matching.

1.6

  • Implement a public plugin API.
  • Add more logging and convert log messages from old-style to new-style format strings.

2.0

Beyond 2.0

  • Implement additional alternate alignment algorithms.
  • Implement the error detection algorithm in ADEPT: https://github.com/LANL-Bioinformatics/ADEPT
  • Implement the quality trimming algorithm used in UrQt: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4450468/
  • Scythe is an interesting new trimmer. Depending on how the benchmarks look in the forthcoming paper, we will add it to the list of tools we compare against Atropos, and perhaps implement their Bayesian approach for adapter match.
  • Experiment with replacing the multicore implementation with an asyncio-based implementation (using ProcessPoolExecutor and uvloop).

While we consider the command-line interface to be stable, the internal code organization of Atropos is likely to change. At this time, we recommend to not directly interface with Atropos as a library (or to be prepared for your code to break). The internal code organization will be stabilized as of version 2.0, which is planned for sometime in 2017.

If you would like to suggest additional enhancements, you can submit issues and/or pull requests at our GitHub page.

Citations

The citation for the original Cutadapt paper is:

Marcel Martin. “Cutadapt removes adapter sequences from high-throughput sequencing reads.” EMBnet.Journal, 17(1):10-12, May 2011. http://dx.doi.org/10.14806/ej.17.1.200

Atropos is currently published as a pre-print on PeerJ, and will be submitted for peer review shortly. For now, you can cite it as:

John P Didion, Marcel Martin, and Francis S Collins. “Atropos: specific, sensitive, and speedy trimming of sequencing reads.” https://peerj.com/preprints/2452/
Release History

Release History

1.1.5

This version

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.1.4

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.1.3

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.1.2

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.1.1

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.1.0

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.23

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.22

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.21

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.20

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.19

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.18

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.17

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.15

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.14

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.13

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.12

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.11

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.10

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.9

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.8

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.7

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.6

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.5

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.4

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.3

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.2

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0.1

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

1.0

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

Download Files

Download Files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

File Name & Checksum SHA256 Checksum Help Version File Type Upload Date
atropos-1.1.5.tar.gz (403.9 kB) Copy SHA256 Checksum SHA256 Source May 18, 2017

Supported By

WebFaction WebFaction Technical Writing Elastic Elastic Search Pingdom Pingdom Monitoring Dyn Dyn DNS Sentry Sentry Error Logging CloudAMQP CloudAMQP RabbitMQ Heroku Heroku PaaS Kabu Creative Kabu Creative UX & Design Fastly Fastly CDN DigiCert DigiCert EV Certificate Rackspace Rackspace Cloud Servers DreamHost DreamHost Log Hosting