Store any file as a fasta file
Project description
Disclaimer: this is only a proof-of-concept (and a joke), please don't actually use this.
bin2fasta
Store any file as a fasta file!
Installation
$ pip install bin2fasta
Usage
$ file foo.png
foo.png: PNG image data, 618 x 257, 8-bit/color RGBA, non-interlaced
$ bin2fasta -o bar.fasta foo.png
319400it [00:00, 683649.99it/s]
$ head -c50 bar.fasta
>Sequence_master
AGTTGAGGCGCCTTACTGCCGAATTAGTTAAGA
$ bin2fasta --decode -o baz.png bar.fasta
159700it [00:00, 455825.67it/s]
$ file baz.png
baz.png: PNG image data, 618 x 257, 8-bit/color RGBA, non-interlaced
$ diff foo.png baz.png
$
Poetry workflow
Only relevant for developers:
Run executable:
$ poetry run bin2fasta
Publish to PyPi:
$ poetry --build publish
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
bin2fasta-0.0.1.tar.gz
(3.3 kB
view hashes)
Built Distribution
Close
Hashes for bin2fasta-0.0.1-py3-none-any.whl
Algorithm | Hash digest | |
---|---|---|
SHA256 | af9ac10e3dfbdb8f815b4fd31dc8abf557fc170167a58299d74f7f170607ce00 |
|
MD5 | ae87decdf9aab75ecc5330a6b6f58218 |
|
BLAKE2b-256 | fc96e395b1fd82a75ec3778d68428e9a895971fe55a7546b4a082343e6bcb89d |