BioForge — High-Performance Bioinformatics Engine
A bioinformatics engine built for Edge Computing.
No Biopython. No heavy dependencies. NumPy core + optional C engine for maximum speed.
Why this exists
Most bioinformatics tools are built for servers with gigabytes of RAM.
BioForge was built for the opposite: low-power hardware, minimal footprint,
maximum speed — running genetic analysis offline and locally.
Two core rules:
- Zero Python loops in the hot path — every operation is vectorised with NumPy.
- 5-bit encoding — every biological symbol fits in 5 bits, saving 37.5% memory vs ASCII.
What's in the box
BioForge is one lightweight engine bundling several tools — a single pip install, a single dependency (NumPy), a shared C backend. Each tool has its own
section (with examples) further down.
| Category | Tools |
|---|---|
| Storage & I/O | 5-bit sequence storage · streaming FASTA/FASTQ parser (C) · .gz / BGZF |
| Sequence transforms | DNA→protein translation · reverse complement · 6-frame translation |
| Alignment | pairwise (Needleman–Wunsch / banded / Smith–Waterman) · multiple sequence alignment (center-star) |
| Genome mapping | long-read seed-chain-align mapper, whole pipeline in C, PAF output — on par with minimap2 on multi-core, ~99.8% accurate |
| Analysis & QC | FastQC-style quality report · GC content · k-mer spectrum |
| Evolution (v7.0) | mutation ranking · stable lineage designation (Pango/autolin-style, no tree) · honest backtesting — bioforge-evolution |
| Evaluation & reality-check (v8.0) | EvolutionBenchmark — judge any evolution predictor honestly (trivial-baseline bar, novel-regime split, bootstrap CI, pretraining-leakage detector) · RealityCheck — filter another tool's mutation hits by real-world traction |
| Nanopore basecalling (v9.0–9.1) | raw electrical signal → bases, from scratch (POD5/FAST5 readers · event detection · own pore-model estimation · Viterbi with stay/skip · iterative rescaling). Pure NumPy, no AI — ~74% on real R9.4 signal |
| Desktop app (v10.0) | the whole engine behind a friendly local window — 5 tabs for non-coders. Double-click .exe or pip install "bioforge[app]" && bioforge-app. Offline, private (DNA Edge) |
Why one engine instead of a pile of separate tools? Fewer resources and less friction — no piping data between programs, no format conversions, one install that runs on low-power/edge hardware. Competitive at each task, and unique in combining them (especially the evolution front).
Key numbers
| Operation | Result |
|---|---|
| Memory (30M bases) | 18.75 MB (37.5% less than plain ASCII) |
| Translation throughput | ~5 M amino acids / second (NumPy) · ~27× faster with C engine |
Bulk translation — translate_many() |
~5.5× faster than one-by-one on 20 K sequences (columnar: one C crossing per batch for unpack, translate and pack; ATG/STOP resolved vectorised) |
| NW alignment 1000×1000 nt | ~165 ms (NumPy) · ~29× faster with C engine |
NW with band="auto" (adaptive, exact) |
~1.3× of parasail (the SIMD specialist) on 1000 nt — adaptive band + AVX2 banded kernel; widens until the optimal path no longer touches the edge, so the result is provably identical to full NW |
| MSA 200 × 1000 nt (center-star) | 0.27 s — 5.3× faster than before the SIMD/adaptive-band work |
| Genome mapping — speed vs minimap2 | on par on multi-core, ~1.18× behind single-thread (E. coli scale, minimap2 -a; tools/bench_vs_minimap2.py) |
| Genome mapping — accuracy vs minimap2 | ~99.8% of reads mapped to the correct position on real E. coli, matching minimap2 (tools/accuracy_vs_minimap2.py) |
| FASTA ingestion (C batch parser) | ~80 M bases / second |
| FASTQ ingestion (C batch parser) | ~14 M bases / s · ~94 K reads / s |
| QC filter 200 K reads (columnar) | 0.28 s — 18.6× faster than per-record |
| vs Biopython — QC filter | ~5–6× faster, identical result |
| vs Biopython — load all in RAM | ~6.9× less memory (115 MB vs 801 MB) · ~9.5× faster |
| Compressed input | .gz read transparently in C (zlib, static-linked) |
FASTQ parsing — parallel (n_threads=0) |
~1.9× faster than single-thread (500 K reads: 0.40 s → 0.21 s) — on par with seqkit stats single-threaded |
| Evolution — mutation ranking | cross-virus AUC ~0.74–0.91 on flu HA, beats the best trivial axis on all 6 held-out tests (trained model runs in pure NumPy) |
| Evolution — judged honestly (Level 6) | on real H3N2: model AUC 0.837 global / 0.631 on novel mutations, over the trivial mutability bar (0.793) — measured by our own EvolutionBenchmark |
| Data integrity | anti-corruption guard refuses to mis-encode a mistyped sequence · property-based invariants over both alphabets · tools/integrity_check.py certificate |
| Nanopore basecaller (Level 7) | ~74% identity on real R9.4 signal (E. coli, n=36, vs production Guppy; v9.0 was 70%, v9.1 lifted it) — from-scratch classical Viterbi, pure NumPy, no AI. Reproducible: tools/bench_basecaller.py |
| Dependencies | NumPy (C engine + trained ranker included, pre-compiled) |
Architecture
┌──────────────────────────────────────────────────────────────┐
│ Level 7 — nanopore.py Signal → bases │
│ from-scratch classical basecaller (Viterbi, pure NumPy) │
├──────────────────────────────────────────────────────────────┤
│ Level 6 — evalkit · realitycheck Honest judgment │
│ judge a predictor · filter mutations by real-world traction │
├──────────────────────────────────────────────────────────────┤
│ Level 5 — evolution · msa · fetch · ai Evolution predictor │
│ mutation ranking · stable lineages · trained MLP (pure NumPy)│
├──────────────────────────────────────────────────────────────┤
│ Level 4 — genomemap · minimizers · refindex Genome mapper │
│ seed-chain-align (minimap2-style) · whole pipeline in C │
├──────────────────────────────────────────────────────────────┤
│ Level 3 — bioforge/aligner.py NW alignment │
│ Anti-diagonal wavefront O(m+n) · mutation detection │
├──────────────────────────────────────────────────────────────┤
│ Level 2 — bioforge/smart_translator.py DNA → Protein │
│ CODON_LUT + sliding_window_view · first-ATG ORF detection │
├──────────────────────────────────────────────────────────────┤
│ Level 1 — bioforge/biocore.py 5-bit storage │
│ BitPacker · PackedSequence · SmartImporter · LUTs │
├──────────────────────────────────────────────────────────────┤
│ C engine — bioforge/engine/engine.c Optional backend │
│ GCC -O3 -fopenmp · auto-loaded via ctypes · NumPy fallback │
└──────────────────────────────────────────────────────────────┘
The 5-bit unified alphabet
Every biological symbol — nucleotides, amino acids, gaps, stop codons and
ambiguous bases — fits in a single 5-bit scheme (32 states).
One encoding covers DNA, RNA, and proteins in the same pipeline.
State Symbol State Symbol
0 Adenine (A) 14 Methionine (M)
1 Cytosine (C) ... (all 20 amino acids: 4–23)
2 Guanine (G) 24 STOP codon (*)
3 Thymine / Uracil 25 Alignment gap (-)
4–23 Amino acids 31 Unknown / ambiguous
Installation
pip install bioforge
Native wheels ship for Windows, Linux and macOS with the C engine pre-compiled inside — no compiler needed. On any other platform BioForge falls back to the pure-NumPy path automatically.
From source (latest main):
git clone https://github.com/erlanders177/bioforge.git
cd bioforge
pip install -e . # only needs NumPy
Requirements
- Python ≥ 3.10
- NumPy ≥ 1.24 — the only runtime dependency
- The C engine ships pre-compiled (OpenMP, zlib and libdeflate statically linked inside the binary). If it can't load on your platform, BioForge falls back to NumPy automatically.
Optional — recompile the C engine (needed only if you build from source on an
unsupported platform, or change engine.c):
python bioforge/engine/build.py
Requires GCC. On Windows: MinGW-w64 / MSYS2. On Linux/Mac: sudo apt install gcc / brew install gcc.
If not compiled, BioForge falls back to NumPy automatically — no code changes needed.
For development and testing:
pip install hypothesis pytest pytest-benchmark
Desktop app — no coding required (v10.0)
BioForge also has a desktop app: the same engine behind a friendly window, for people who don't write code. Everything runs locally and offline — your DNA never leaves your machine (DNA Edge). Five tabs, each with a plain-language explanation:
- 🧬 Sequences — browse your FASTA/FASTQ, see each sequence's type and size, and translate DNA → protein (codon by codon, colour-coded by amino-acid type).
- 📊 Quality — a FastQC-style report for FASTQ (per-position quality, GC, Phred), drawn as inline charts.
- ⚗️ Align — compare two sequences and see their differences (mutations) highlighted.
- 〜 Nanopore — turn raw electrical signal (POD5/FAST5) into DNA bases with our own classical basecaller, then reuse those bases anywhere in the app.
- 🔮 Evolution — rank which protein mutations may rise, and reality-check a specific one.
Get it — two faces, same code at the same version:
- Just double-click (no Python): download
BioForge-<version>-windows.zipfrom the latest release, unzip, and runBioForge.exe. Self-contained — nothing to install. (The.exeis built automatically and attached to each release.) - From the package (for coders):
pip install "bioforge[app]" bioforge-app
Quick start
Import and encode a FASTA sequence
from bioforge import SmartImporter, SeqType
records = SmartImporter.from_string(""">gene_1
ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCC
""")
seq = records[0]
print(seq.n_symbols) # 33
print(len(seq.data)) # 21 (37.5% smaller than ASCII)
print(seq.to_string()) # ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCC
Stream a huge FASTA/FASTQ with constant RAM
from bioforge import SmartImporter
# One PackedSequence at a time — never loads the whole file
for seq in SmartImporter.stream("genome.fa"):
print(seq.header, seq.n_symbols)
# FASTQ yields FastqRecord (sequence + Phred qualities)
for rec in SmartImporter.stream_fastq("reads.fastq"):
if rec.passes_quality(20):
process(rec.sequence)
Quality-filter millions of reads — the fast lane (columnar)
from bioforge import SmartImporter
total = passed = 0
for batch in SmartImporter.stream_fastq_batches("reads.fastq"):
mask = batch.passes(20) # ONE NumPy op for thousands of reads
total += len(batch)
passed += int(mask.sum())
kept = batch.filter(mask) # new ReadBatch, no per-read objects
print(f"{passed}/{total} reads with mean quality >= 20")
stream_fastq_batches keeps a whole batch as contiguous matrices instead of
one object per read, so filtering 200 000 reads drops from ~5.3 s to ~0.28 s.
Materialise a single read only when you need it: batch[i] → FastqRecord.
Compressed .gz files are read transparently (decompressed in C):
for rec in SmartImporter.stream_fastq("reads.fastq.gz"): # no manual gunzip
...
Pass n_threads to go multi-core (an adaptive dispatcher picks the best path):
# plain → parallel parse · .gz → libdeflate (~2× faster) + parse
for batch in SmartImporter.stream_fastq_batches("reads.fastq.gz", n_threads=0):
... # n_threads: 1 = sequential (constant RAM) · >1 = threads · 0 = all cores
Reading compressed FASTQ is ~1.6× faster this way (libdeflate beats zlib); plain-file parse parallelism is memory-bandwidth bound, so its gain is modest on few cores but scales on many-core servers.
BGZF — parallel-decompressible .gz (~2× faster reads)
A BGZF file is a valid .gz (any gunzip reads it) but split into
independent 64 KB blocks, so BioForge decompresses it across all cores. Convert
once a file you'll process repeatedly:
python -m bioforge.bgzf reads.fastq # or: bioforge-bgzip reads.fastq
# → reads.fastq.gz (BGZF). Reads at ~113 M bases/s vs ~58 for plain .gz.
BioForge auto-detects BGZF and routes to the parallel path; plain .gz keeps
using single-thread libdeflate.
GC content and k-mer spectrum — vectorised over a whole batch
from bioforge import SmartImporter
spectrum = None
for batch in SmartImporter.stream_fastq_batches("reads.fastq"):
gc = batch.gc_content() # GC fraction per read (NumPy array)
s = batch.kmer_spectrum(k=4) # counts of all 4^4 k-mers in the batch
spectrum = s if spectrum is None else spectrum + s
# spectrum[i] = how many times k-mer #i appears across the whole file
Both run with zero per-read objects; ambiguous bases (N) are skipped from k-mers.
Fast FASTQ quality report (FastQC-style)
python -m bioforge.qcreport reads.fastq.gz # or: bioforge-qc reads.fastq.gz
One pass, constant RAM. Reports read/base counts, length, overall GC, mean
quality, %reads ≥ Q20/Q30, plus per-read quality and GC histograms,
per-position mean quality (the FastQC signature plot) and per-base
composition — all built on the columnar API. Use -o report.txt to save it.
Translate DNA to protein
from bioforge import SmartTranslator
protein = SmartTranslator.translate(seq)
print(protein.to_string()) # MVHLTPEEKSA
Detect mutations between two sequences
from bioforge import SequenceAligner, format_alignment
result = SequenceAligner.align(seq_ref, seq_query)
print(f"Identity: {result.identity:.1%}")
print(format_alignment(result))
for mut in result.mutations:
print(mut)
# Mutation(kind='substitution', pos_a=18, pos_b=18, sym_a='A', sym_b='T')
Map long reads to a genome (Level 4 — seed-chain-align)
Locate reads in a reference far beyond what the O(m·n) aligner can handle, minimap2-style: minimizer seeding → chaining → banded extension of the full read. The entire pipeline runs in C behind an opaque index handle; Python is a thin cover (with a verified, identical NumPy fallback).
from bioforge import GenomeAligner
# Single sequence, or a whole multi-contig genome:
mapper = GenomeAligner({"chr1": chr1_seq, "chr2": chr2_seq, "plasmid": p_seq})
for m in mapper.map(read):
print(m.to_paf()) # standard PAF, one line per mapping
print(m.target_name, m.strand, m.target_start, f"{m.identity:.1%}")
# Map many reads in parallel — OpenMP inside the C engine (GIL-free):
results = mapper.map_batch(reads, n_processes=0) # 0 = all cores
Handles multi-chromosome references (reports the contig + local coordinates),
both strands, aligns the full read, tolerates mismatches/indels, and reports a
mapping quality. Built once, the C index is reused for every query;
map_batch maps the whole batch in a single C call parallelised with OpenMP.
Speed, honestly. The whole pipeline runs in C (SIMD banded extension + OpenMP batch). In a same-machine head-to-head (
tools/bench_vs_minimap2.py, 4.8 Mb genome, 6000 simulated reads at 5% error,minimap2 -a), BioForge is on par with minimap2 on multiple cores (~4.3–5.0 vs ~4.3–4.9 Mb/s, sometimes ahead) and ~1.18× behind single-threaded (~1.87 vs ~2.2 Mb/s) — both map all reads. Please reproduce it yourself and tell me where it breaks.Honest caveats: this is E. coli scale with simulated reads; minimap2 — years of hand-tuning, by a team — may well pull ahead at human-genome scale, on real noisy data, or with many cores. This is not "we beat minimap2"; it's "a from-scratch,
pip install-and-go engine got competitive," and the goal from here is a niche it doesn't occupy (see Roadmap).
Reproduce the benchmark yourself (Linux/WSL, with minimap2 installed):
pip install bioforge
git clone https://github.com/erlanders177/bioforge.git && cd bioforge
python3 tools/bench_vs_minimap2.py --genome 4800000 --reads 6000 --error 0.05
# prints Mb/s for minimap2 and BioForge at 1 thread and all cores, same reads.
# Numbers are relative to your machine — report back what you get.
Accuracy — fast is worthless if it's wrong. On a real E. coli K-12 genome (4.64 Mb, 5000 simulated reads, recording each read's true origin, ±50 bp tolerance): BioForge maps ~99.8% of reads to the correct position — matching minimap2 (99.8% at 5% error, 99.7% vs 99.9% at 10%), with 99.8% concordance between the two. So it's not fast-at-the-cost-of-correctness. Reproduce with
tools/accuracy_vs_minimap2.py(grab a real genome from NCBI first). Honest note: at higher error minimap2 is marginally ahead, and this is E. coli scale — larger genomes may differ.
Align many sequences at once (Level 4 — multiple sequence alignment)
Line up several sequences column-by-column — the basis for consensus, phylogeny and the evolution front. Uses the center-star heuristic (align all to a central sequence via the C aligner, then merge gaps), ideal for sets of similar sequences (e.g. the same gene across strains over time).
from bioforge import align_multiple
msa = align_multiple([
"ATGGCCTTAGGCTA",
"ATGGCGTTAGGCTA",
"ATGGCCTTAGCTA", # a deletion
"ATGGCCTTAGGCTAA", # an insertion
])
for row in msa.aligned:
print(row) # all rows same length, homologous columns
print(msa.consensus()) # majority consensus (N where ambiguous)
Every row with its gaps removed reproduces the original sequence exactly (no data loss). Honest scope: center-star is the simple, correct starting point and shines on similar sequences; serious aligners (Clustal Omega, MAFFT, MUSCLE) use progressive + iterative refinement for divergent sets — a future upgrade.
Evolution: rank the mutations that will rise (Level 5 — v7.0)
Given dated sequences of a gene under selection (e.g. a flu HA across seasons),
BioForge ranks which mutations are most likely to rise next, designates
stable lineages, and backtests every prediction against the trivial "tomorrow
= today" baseline. Genome-agnostic: nothing about flu or any organism is
hard-coded. The date goes in the FASTA header (a year, or YYYY-MM).
# Rank candidate mutations (site, target residue) by probability of rising:
bioforge-evolution rank strains.fasta --top 20
# Only mutations never seen before — where counting can't help and this earns its keep:
bioforge-evolution rank strains.fasta --novel --translate
# Is the model actually better than "tomorrow = today"? (the honest judge)
bioforge-evolution backtest strains.fasta
# Designate stable lineages (Pango/autolin-style) with their defining mutations:
bioforge-evolution lineages strains.fasta
from bioforge import rank_mutations
r = rank_mutations(protein_seqs, years, novel_only=True)
for site, residue, score in r.ranked[:10]:
print(site + 1, residue, round(score, 3))
How it works, and the honesty that comes with it (this is a research tool, and its own measured limits are baked in):
- The right question. Predicting exact frequencies is a dead end — it ties the naive baseline at every horizon we tested (3–18 months), because the naive baseline is nearly optimal there. So instead we do what the field actually does (EVEscape, Łuksza): rank mutations (AUC). Here the naive baseline doesn't even play — "nothing changes" ranks nothing.
- Three genome-agnostic axes feed a small trained model: how a site has changed in the past (a data-driven stand-in for structural accessibility), the physico-chemical (dis)similarity of the substitution, and its recent growth. Notably, the "escape" dissimilarity axis is inverted — in flu HA the substitutions that rise are conservative, replicated across H3N2, H1N1 and B. It measures viability, not escape (without a structural-accessibility term, most of a domain is core: "disruptive" means "breaks the protein", not "escapes").
- The model is a tiny neural net (MLP 2×64) run in pure NumPy — training used
PyTorch as scaffolding, but the shipped model is a 39 KB
.npzand inference is three matrix multiplies. No PyTorch, no GPU, runs on a laptop. It beats a plain linear model on all six held-out tests (per-virus and cross-virus — trained on two influenza types, tested on a third), which is where it helps most. - What it is not. None of this is scientifically novel — DERIVE, EVEscape and
Hie et al. already rank escape mutations and cross viruses, with more resources and
usually better. An optional ESM-2 axis (
pip install bioforge[ai]) exists but suffers pretraining leakage (its AUC drops ~0.20 on data after its training cutoff — measured, and off by default). The value here is the integrated, honest, laptop-runnable box, not a new state of the art.
Judge a predictor honestly (Level 6 — v8.0)
Building the Level 5 predictor was mostly a fight against our own measurements flattering us. Every check below exists because it caught us:
from bioforge import EvolutionBenchmark
bench = EvolutionBenchmark(sequences, dates) # real, dated sequences
report = bench.judge(my_predictor) # any f(Context) -> scores
print(report)
── VEREDICTO ─────────────────────────────────────────────
AUC global 0.837
AUC en NUEVAS 0.631 (el régimen difícil)
listón trivial 0.793 (mutabilidad del sitio)
IC95% del AUC [0.830, 0.848]
(220,092 candidatas · 20 cortes)
→ APORTA de verdad: supera el listón trivial y aguanta en NUEVAS.
- The bar is not 0.5. It is the best free axis (current frequency, site mutability, physico-chemical conservation). Our own headline "AUC 0.80" turned out to be exactly the mutability axis — a tautology, not a prediction.
- Two regimes. Mutations already circulating (where counting is enough) are split from genuinely new ones. Our hand-tuned axes score ~0.52 on new mutations — chance. The trained model scores 0.631. That gap is what the AI buys.
- Bootstrap CI. Small wins evaporate when you resample. If the interval touches 0.5, the verdict says not demonstrated.
- Pretraining-leakage detector. Compares AUC before/after a model's training cutoff, subtracting the drop of a trivial control axis. In a planted test a cheating predictor scored AUC 0.863 with a clean CI [0.859, 0.866] — better than the trivial bar (0.793), and 0.857 on the hard regime — and was still flagged (leak −0.438). Without this check we would have published that number. It is the same signature we measured on ESM-2 (−0.20 after its cutoff).
Contextis leak-free by construction: a predictor is only ever handed time bins before the one being scored, so lookahead is not possible by accident.cross_validatere-runs the battery on other organisms to test whether a model generalises or memorised one virus.
The point of Level 6 is not to win a benchmark. It is that a claim about predicting evolution should be hard to make by mistake.
These numbers are measured on real H3N2 hemagglutinin (900 sequences, 2013–2022, 220k candidate mutations). An earlier draft reported 0.861/0.613 — computed, we later found, on a corrupted multiple alignment (a silent bug that packed every protein as DNA, turning non-ACGT residues into
N). The bug is fixed, the model retrained on clean alignments, and every figure above re-measured. The two honesty tools in this section are what surfaced the corruption in the first place.
Filter another tool's hits by reality (Level 6 — v8.0)
evalkit judges a whole predictor. RealityCheck judges individual mutations:
of the "concerning" variants some other tool (EVEscape, ESM-2, a DMS assay) hands
you, which ones have real traction in the population? It plugs in behind any of
them.
from bioforge import RealityCheck
rc = RealityCheck(sequences, dates) # real, dated sequences
survivors = rc.filter(candidates_from_another_tool) # keeps only what has traction
print(rc.check("N145K"))
- Two tiers, never mixed.
OBSERVADO— the mutation already exists in the record, so we return its real trajectory (this is evidence).ESTIMADO— never seen, so the trained model estimates it (this is a conjecture, and it says so). - Each tier's reliability is measured separately and travels with the verdict. On real H3N2: observed AUC 0.97 (survival of already-circulating variants is largely seen, not guessed), estimated AUC 0.72 (genuine prediction for the novel ones).
- "Survival" means reaching or holding real presence, not "rising 5%". A variant already at 98 % cannot rise but is the clearest survivor there is — scoring rise would mark it a failure (ceiling effect). That is exactly the question you asked: would this mutation survive out there?
- Calibrated against the historical record: 0.70 means ≈70 % of past mutations
that scored ~0.70 went on to establish. Resilient: one malformed entry in a
batch never sinks the rest (it comes back
NO EVALUABLE).
Coordinates note: positions are alignment-column indices of your data, not a standard scheme (e.g. H3 numbering). If you paste
N145Kfrom a paper, the tool tells you when the wildtype residue it expected there disagrees — a hint you are in a different numbering.
Basecall a nanopore read from raw signal (Level 7 — v9.0)
Oxford Nanopore devices push DNA through a pore and measure the ionic current — raw electrical signal. Turning that signal back into bases is basecalling. BioForge does it from scratch, in pure NumPy, with no neural network — the classical route (a Viterbi HMM over a k-mer pore model), the same algorithmic family as the Level 3 aligner.
from bioforge import read_fast5, basecall # pip install "bioforge[nanopore]"
read = next(iter(read_fast5("read.fast5"))) # POD5 also: read_pod5(...)
bases = basecall(read.to_picoamperes(), pore_model, k=6)
- Reads real signal:
read_pod5(modern) andread_fast5(legacy) — the only place an optional dependency is used, purely to open the file format. Everything after (normalise · detect events · estimate the pore model · Viterbi) is pure NumPy. - Learns its own pore model (
estimate_pore_model) from labelled signal rather than shipping someone else's table. - Viterbi with stay/step/skip (
viterbi_basecall) so imperfect segmentation no longer breaks the call — the classical fix that took us from 58 % to 70 %. - Iterative rescaling (v9.1): a first pass tells us which k-mer each event is, then the per-read scale is refit to the actual levels of those k-mers — that plus a better stay probability lifted real-signal accuracy from ~70 % to ~74 %.
Honest, reproducible numbers. On real captured R9.4 signal (E. coli, n=36,
identity to the production Guppy basecall, aligned locally with our own aligner):
mean ~74.5 %, median ~74 %, range 68–82 %. That is squarely in the range of the
historical classical basecallers (nanocall ~68–85 %) and far below the ~99 % of the
neural Dorado — which is the honest point: the classical route is an R9-era method,
and without AI it has a ceiling. Reproduce it yourself: python tools/bench_basecaller.py.
Why not R10 (modern chemistry)? It reads ~9 bases at once → 4⁹ = 262 144 hidden states, so an O(T·states) Viterbi is infeasible on a laptop; and ONT ships no flat k-mer table for R10 (its models are neural, inside Dorado). That wall is the real reason the field moved to neural basecalling. BioForge reads R10 signal fine; it just doesn't pretend a classical decoder can call it well.
Full mutation analysis pipeline (DNA + protein)
from bioforge import run, build_report
result = run("reference.fa", "query.fa", mode="both")
print(build_report(result))
Error handling
from bioforge import BioForgeError, TranslationError, SmartImporter, SmartTranslator
try:
for rec in SmartImporter.stream_fastq("reads.fastq.gz"):
protein = SmartTranslator.translate(rec.sequence)
except TranslationError as e:
print(f"Translation failed: {e}") # e.g. no ATG found
except BioForgeError as e:
print(f"BioForge error: {e}") # ANY engine error: parse, I/O, decompress…
One exception family. Every engine error subclasses BioForgeError, so a
single except BioForgeError catches them all — translation, alignment, parsing,
file I/O (BioForgeIOError), engine/decompression (EngineError). Each also
subclasses the matching builtin (ValueError, OSError, RuntimeError…), so
existing except OSError-style code keeps working.
Run the verifier (no coding knowledge required)
python check.py
Project structure
bioforge/ Python package — all core modules
__init__.py Public API entry point (from bioforge import ...)
biocore.py Level 1 — 5-bit storage engine
smart_translator.py Level 2 — DNA → protein translation
aligner.py Level 3 — pairwise alignment + mutation detection
minimizers.py Level 4 — canonical (w, k) minimizers (C + NumPy)
refindex.py Level 4 — reference minimizer index (hash-sorted lookup)
genomemap.py Level 4 — GenomeAligner: seed-chain-align → PAF
msa.py Multiple sequence alignment (center-star) — evolution's base
evolution.py Level 5 — mutation ranking, stable lineages, backtesting
fetch.py Level 5 — dated NCBI Entrez download (stdlib, cached + retries)
evocli.py Level 5 — bioforge-evolution CLI (rank/backtest/lineages)
ai/viability.py Level 5 — optional ESM-2 axis (bioforge[ai], lazy-loaded)
evalkit.py Level 6 — honest predictor judge (EvolutionBenchmark)
realitycheck.py Level 6 — mutation reality filter (RealityCheck)
nanopore.py Level 7 — from-scratch basecaller (signal → bases, pure NumPy)
app/ Desktop app (v10.0) — local window over the engine (bioforge-app)
main.py PyWebview launcher (window + native file dialogs)
backend.py The bridge the UI calls (Api) — tested without a window
index.html The whole interface (vanilla JS, offline, inline SVG charts)
data/ UI resources: pore model + app icon
data/ Trained mutation-ranker weights (.npz, in the wheel)
analyze.py Full pipeline: DNA + protein analysis, report generation
qcreport.py Fast FASTQ quality report (FastQC-style, columnar)
bgzf.py BGZF converter (parallel block gzip) — bioforge-bgzip
engine/
engine.c C source — pack/unpack, NW, translate, parser, mapper
engine.dll Compiled C backend (Windows; .so on Linux/macOS)
_loader.py ctypes wrapper with automatic NumPy fallback
build.py Compiles the DLL/SO (auto-detects GCC)
check.py Non-programmer verifier (runs all checks automatically)
conftest.py Pytest fixtures shared across all tests
tools/
visor.py Interactive step-by-step translator (CLI)
comparador.py Sequence comparator tool (CLI)
stress_test.py 30M-base performance benchmark
bench_vs_biopython.py BioForge vs Biopython: time + RAM (FASTQ parse/QC/load)
tests/
test_biocore.py L1: property-based tests (Hypothesis) + benchmarks
test_translator.py L2: genetic code correctness + error paths
test_aligner.py L3: alignment properties + mutation detection
test_analyze.py Pipeline: full integration tests + CLI tests
test_streaming.py Streaming/batch parser + columnar API (Sequence/ReadBatch)
test_qcreport.py FASTQ quality report (qcreport.py)
test_minimizers.py L4: canonical minimizers (C == NumPy parity)
test_refindex.py L4: reference index lookup
test_genomemap.py L4: seed-chain-align, multi-contig, PAF, robustness
test_cindex.py L4: opaque C index parity (bio_index_build)
test_msa.py MSA: no-corruption invariant (DNA + protein)
test_evolution.py L5: ranking, stable lineages, trained model
test_evalkit.py L6: the honest judge (baselines, leakage, regimes)
test_realitycheck.py L6: mutation reality filter (observed vs estimated)
test_integrity.py Anti-corruption net: property-based, both alphabets
test_nanopore.py L7: signal I/O, event detection, Viterbi basecaller
test_app_backend.py Desktop app: the Api bridge, tested without opening a window
docs/
architecture.md Design rules, levels, encoding details
api_reference.md Code examples for every module
benchmarks.md Measured numbers and methodology
roadmap.md Status and planned extensions
How the vectorisation works
Translation (Level 2)
① decode PackedSequence → uint8 array [0–3 per nucleotide]
② find first ATG → C engine scan / NumPy sliding_window_view
③ extract ORF, reshape → (N, 3) codon matrix
④ base-4 index → idx = n₁×16 + n₂×4 + n₃ (vectorised)
⑤ CODON_LUT[idx] → amino acid array (single fancy-index)
⑥ argmax on STOP mask → truncate at stop codon
Alignment (Level 3)
Needleman-Wunsch has a cell-level data dependency that prevents full 2D vectorisation. The solution: anti-diagonal wavefront.
Cells on the same anti-diagonal (i + j = d) are mutually independent,
so each diagonal is a single vectorised operation.
Python-level iterations: O(m+n) instead of O(m·n).
When the C engine is available, the entire DP matrix is computed in C with OpenMP, giving ~29× speedup over the NumPy wavefront.
C engine
bioforge/engine/engine.c provides optimised implementations of all hot-path
operations. Loaded automatically via ctypes at import time.
If engine.dll is missing, all code falls back to NumPy silently.
from bioforge.engine._loader import C_AVAILABLE
print(C_AVAILABLE) # True if C engine loaded, False if using NumPy fallback
Running the tests
# Full test suite (546 tests)
pytest tests/ -v
# Benchmarks only
pytest tests/ --benchmark-only
# Quick smoke check (no coding knowledge required)
python check.py
Known limitations
| Limitation | Detail |
|---|---|
| Aligner memory (full NW) | O(m·n) matrix — sequences > 15 000 bp may exhaust RAM. Use band=N for large sequences. |
| Protein auto-detection | Sequences without E/F/I/L/P/Q/* are classified as nucleotides. Use force_type=SeqType.PROTEIN to override. Since v8.0, mis-encoding is no longer silent: the encoder refuses a sequence that is mostly invalid for its type (would-be corruption raises SequenceValueError). |
| RealityCheck coordinates | Positions are alignment-column indices of your data, not a standard scheme (e.g. H3 numbering). The tool warns when the wildtype it expected at a position disagrees with what you passed. |
| C engine | Ships pre-compiled in the PyPI wheels. Building from source on an unsupported platform needs GCC (python bioforge/engine/build.py). |
| Banded NW (NumPy fallback) | Without the C engine, banded NW uses the full matrix with NEG_INF masking — same result, standard RAM. |
| Genome mapper — tested scale | Benchmarked on par with minimap2 on multi-core and ~1.18× behind single-threaded at E. coli scale with simulated reads (tools/bench_vs_minimap2.py). Not yet validated at human-genome scale or on real noisy data, where minimap2 may pull ahead. |
Roadmap
- Level 1 — 5-bit storage, FASTA parser, SmartImporter
- Level 2 — vectorised genetic code translation (C + NumPy)
- Level 3 — Needleman-Wunsch alignment + mutation detection (C + NumPy)
- Full mutation analysis pipeline (DNA + protein, 3 modes)
- BioForgeError exception hierarchy for library users
- Reverse complement vectorised —
PackedSequence.reverse_complement() - 6-frame translation —
SmartTranslator.translate_all_frames() - Banded NW —
SequenceAligner.align(seq_a, seq_b, band=N) - Smith-Waterman local alignment —
SequenceAligner.align_local() - Streaming FASTA/FASTQ parser in C —
SmartImporter.stream()/stream_fastq() - Batch parser (5-bit encoding in C) — ~80 M bases/s FASTA, ~94 K reads/s FASTQ
- Columnar QC API —
stream_fastq_batches()·ReadBatch.passes()/filter() - Compressed
.gzdecoded in C (zlib, static-linked, transparent) - Object-free columnar k-mer spectrum + per-read GC —
kmer_spectrum()/gc_content() - Benchmark vs Biopython —
tools/bench_vs_biopython.py - Fast FASTQ quality report (FastQC-style) —
bioforge-qc/bioforge.qcreport - Adaptive multi-core dispatcher —
n_threads=: parallel parse + libdeflate.gz - BGZF parallel-decompressible
.gz+ converter —bioforge-bgzip - Native per-platform wheels on PyPI (cibuildwheel) —
pip install bioforge - Long-read / genome-scale aligner —
GenomeAligner(seed-chain-align, PAF) - Whole mapping pipeline in C behind an opaque index —
bio_map_read/bio_map_batch(OpenMP) - SIMD banded extension (AVX2, int32 + int16) —
_nw_banded_diag_simd(v6.0 / v6.2) - Columnar
map_batchoutput → full multi-core scaling (v6.1) - Head-to-head benchmark vs minimap2 (
tools/bench_vs_minimap2.py, WSL) — on par multi-core - Multiple sequence alignment (center-star) —
align_multiple(v6.3) - Evolution front — mutation ranking, stable lineages, honest backtesting —
bioforge-evolution(v7.0) - Trained mutation-ranker (MLP in pure NumPy, no PyTorch at inference) + optional ESM-2 axis (v7.0)
- Level 6 — honest predictor judge
EvolutionBenchmark(trivial-baseline bar · novel-regime split · bootstrap CI · pretraining-leakage detector) (v8.0) - Level 6 — reality filter
RealityCheck: rank another tool's mutation hits by real-world traction, observed vs estimated tiers (v8.0) - Anti-corruption integrity net — encode guard + property-based invariants (both alphabets) +
tools/integrity_check.py(v8.0) - Level 7 — nanopore basecaller from scratch (POD5/FAST5 readers · event detection · own pore-model estimation · Viterbi stay/skip · pure NumPy) — ~70 % on real R9.4 (v9.0)
- Nanopore: iterative per-read rescaling + tuned transitions → ~74 % on real R9.4 (v9.1)
- Nanopore: keep lifting (drift term, homopolymers, trained transition/emission model); pluggable Dorado backend when present
- Structural-accessibility axis (to separate escape from viability) — the term EVEscape has and we don't
- Validate the mapper at human-genome scale on real (non-simulated) reads
- Phase 2 — desktop application (v10.0): the whole engine behind a friendly local window (5 tabs), for non-coders. Ships inside the package (
bioforge.app, launch withbioforge-app) and as a self-contained.exe, auto-built and attached to each release. Local, no servers, privacy-first — your DNA never leaves the machine - Phase 3 — a true predictor, built to beat the honest bar Level 6 now measures (0.631 on novel mutations)
References & inspiration
BioForge's genome mapper (Level 4) is an independent, from-scratch implementation of well-established, published algorithms. No third-party source code is included or copied — only the ideas from the scientific literature, which is what publishing them is for. With gratitude to:
- Minimap2 — Li, H. (2018). Minimap2: pairwise alignment for nucleotide
sequences. Bioinformatics, 34(18), 3094–3100. The seed-chain-align strategy
and the chaining dynamic program that inspired
genomemap.py. (paper · MIT-licensed source) - Minimizers — Roberts, M., Hayes, W., Hunt, B. R., Mount, S. M., &
Yorke, J. A. (2004). Reducing storage requirements for biological sequence
comparison. Bioinformatics, 20(18), 3363–3369. The (w, k) minimizer sampling
behind
minimizers.py. - Needleman–Wunsch (1970) and Smith–Waterman (1981) — the classic dynamic-programming alignments behind Level 3.
BioForge is not affiliated with or endorsed by the authors of the above.
Author
Aarón Aranda Torrijos — github.com/erlanders177
License
PolyForm Noncommercial 1.0.0 — free for personal, academic and research use.
Commercial use requires explicit permission from the author.
See LICENSE for full terms.
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distributions
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file bioforge-10.0.0.tar.gz.
File metadata
- Download URL: bioforge-10.0.0.tar.gz
- Upload date:
- Size: 893.3 kB
- Tags: Source
- Uploaded using Trusted Publishing? Yes
- Uploaded via:
twine/7.0.0 CPython/3.13.14
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
a92344da11f6450816aaf7f2d6065c56bd49de7533cbbf447593692cfd748441
|
|
| MD5 |
3c06af66088f3a453fe1f66adc8cc30d
|
|
| BLAKE2b-256 |
3e1b0c8b37b761104cec53de3dbbf2acd3a28bca95e0a15a887a65bb42cca7b9
|
Provenance
The following attestation bundles were made for bioforge-10.0.0.tar.gz:
Publisher:
wheels.yml on erlanders177/bioforge
-
Statement:
-
Statement type:
https://in-toto.io/Statement/v1 -
Predicate type:
https://docs.pypi.org/attestations/publish/v1 -
Subject name:
bioforge-10.0.0.tar.gz -
Subject digest:
a92344da11f6450816aaf7f2d6065c56bd49de7533cbbf447593692cfd748441 - Sigstore transparency entry: 2465030793
- Sigstore integration time:
-
Permalink:
erlanders177/bioforge@f8c0c9fa507bc80378697ddd3f41593a733b1d72 -
Branch / Tag:
refs/tags/v10.0.0 - Owner: https://github.com/erlanders177
-
Access:
public
-
Token Issuer:
https://token.actions.githubusercontent.com -
Runner Environment:
github-hosted -
Publication workflow:
wheels.yml@f8c0c9fa507bc80378697ddd3f41593a733b1d72 -
Trigger Event:
push
-
Statement type:
File details
Details for the file bioforge-10.0.0-py3-none-win_amd64.whl.
File metadata
- Download URL: bioforge-10.0.0-py3-none-win_amd64.whl
- Upload date:
- Size: 827.5 kB
- Tags: Python 3, Windows x86-64
- Uploaded using Trusted Publishing? Yes
- Uploaded via:
twine/7.0.0 CPython/3.13.14
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
c425ce88ca4edb028e83e8e26da33583b25957a03eb016b4ef2f99365d17e4a3
|
|
| MD5 |
f669d2b76daab6a06cdfcd0a1d848596
|
|
| BLAKE2b-256 |
425bef216aa50d217c0c03c9b73a89574d92767018b4349a98a684672278d4ae
|
Provenance
The following attestation bundles were made for bioforge-10.0.0-py3-none-win_amd64.whl:
Publisher:
wheels.yml on erlanders177/bioforge
-
Statement:
-
Statement type:
https://in-toto.io/Statement/v1 -
Predicate type:
https://docs.pypi.org/attestations/publish/v1 -
Subject name:
bioforge-10.0.0-py3-none-win_amd64.whl -
Subject digest:
c425ce88ca4edb028e83e8e26da33583b25957a03eb016b4ef2f99365d17e4a3 - Sigstore transparency entry: 2465030866
- Sigstore integration time:
-
Permalink:
erlanders177/bioforge@f8c0c9fa507bc80378697ddd3f41593a733b1d72 -
Branch / Tag:
refs/tags/v10.0.0 - Owner: https://github.com/erlanders177
-
Access:
public
-
Token Issuer:
https://token.actions.githubusercontent.com -
Runner Environment:
github-hosted -
Publication workflow:
wheels.yml@f8c0c9fa507bc80378697ddd3f41593a733b1d72 -
Trigger Event:
push
-
Statement type:
File details
Details for the file bioforge-10.0.0-py3-none-manylinux_2_28_x86_64.whl.
File metadata
- Download URL: bioforge-10.0.0-py3-none-manylinux_2_28_x86_64.whl
- Upload date:
- Size: 815.3 kB
- Tags: Python 3, manylinux: glibc 2.28+ x86-64
- Uploaded using Trusted Publishing? Yes
- Uploaded via:
twine/7.0.0 CPython/3.13.14
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
82c9e79460bc059aab50850029d0fba3ae9f7fdb091271ecd7f4cadc2ca1fed9
|
|
| MD5 |
6662f96a3fd8de17932915bf85da5232
|
|
| BLAKE2b-256 |
f9e42c07544dd9237d1b54b99d231569912baa67d06b1fda18025507492612ae
|
Provenance
The following attestation bundles were made for bioforge-10.0.0-py3-none-manylinux_2_28_x86_64.whl:
Publisher:
wheels.yml on erlanders177/bioforge
-
Statement:
-
Statement type:
https://in-toto.io/Statement/v1 -
Predicate type:
https://docs.pypi.org/attestations/publish/v1 -
Subject name:
bioforge-10.0.0-py3-none-manylinux_2_28_x86_64.whl -
Subject digest:
82c9e79460bc059aab50850029d0fba3ae9f7fdb091271ecd7f4cadc2ca1fed9 - Sigstore transparency entry: 2465030925
- Sigstore integration time:
-
Permalink:
erlanders177/bioforge@f8c0c9fa507bc80378697ddd3f41593a733b1d72 -
Branch / Tag:
refs/tags/v10.0.0 - Owner: https://github.com/erlanders177
-
Access:
public
-
Token Issuer:
https://token.actions.githubusercontent.com -
Runner Environment:
github-hosted -
Publication workflow:
wheels.yml@f8c0c9fa507bc80378697ddd3f41593a733b1d72 -
Trigger Event:
push
-
Statement type:
File details
Details for the file bioforge-10.0.0-py3-none-macosx_11_0_arm64.whl.
File metadata
- Download URL: bioforge-10.0.0-py3-none-macosx_11_0_arm64.whl
- Upload date:
- Size: 989.3 kB
- Tags: Python 3, macOS 11.0+ ARM64
- Uploaded using Trusted Publishing? Yes
- Uploaded via:
twine/7.0.0 CPython/3.13.14
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
a6c5bc7781b25800d01ac35e1c85916ff260b0d9a82fed622a2cc03b7462777e
|
|
| MD5 |
9790b393fea941889c1867d6a1a1abff
|
|
| BLAKE2b-256 |
ea9db378244f691a374d1ba36be500940cd54514358495b767eb75c2064b7d77
|
Provenance
The following attestation bundles were made for bioforge-10.0.0-py3-none-macosx_11_0_arm64.whl:
Publisher:
wheels.yml on erlanders177/bioforge
-
Statement:
-
Statement type:
https://in-toto.io/Statement/v1 -
Predicate type:
https://docs.pypi.org/attestations/publish/v1 -
Subject name:
bioforge-10.0.0-py3-none-macosx_11_0_arm64.whl -
Subject digest:
a6c5bc7781b25800d01ac35e1c85916ff260b0d9a82fed622a2cc03b7462777e - Sigstore transparency entry: 2465031006
- Sigstore integration time:
-
Permalink:
erlanders177/bioforge@f8c0c9fa507bc80378697ddd3f41593a733b1d72 -
Branch / Tag:
refs/tags/v10.0.0 - Owner: https://github.com/erlanders177
-
Access:
public
-
Token Issuer:
https://token.actions.githubusercontent.com -
Runner Environment:
github-hosted -
Publication workflow:
wheels.yml@f8c0c9fa507bc80378697ddd3f41593a733b1d72 -
Trigger Event:
push
-
Statement type: