Skip to main content

Dash SeqViz

Dash SeqViz is a Dash component library that provides a Python wrapper for the SeqViz JavaScript library. SeqViz is a powerful DNA, RNA, and protein sequence visualization tool that supports circular and linear viewers, annotations, primers, restriction enzymes, and more.

Features

  • Multiple Viewer Types: Support for linear, circular, and both viewers
  • Rich Annotations: Add annotations, primers, highlights, and translations to sequences
  • Restriction Enzymes: Visualize restriction enzyme cut sites
  • Interactive: Full interactivity including selection, search, and zooming
  • Custom Styling: Comprehensive styling options
  • Dash Integration: Seamless integration with Dash applications and callbacks

Quick Start

from dash_seqviz import SeqViz
from dash import Dash, html

app = Dash(__name__)

app.layout = html.Div([
    SeqViz(
        id='my-seqviz',
        seq="TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC",
        name="J23100",
        viewer="both",
        annotations=[
            {
                "start": 0,
                "end": 22,
                "name": "Strong promoter",
                "direction": 1,
                "color": "blue"
            }
        ],
        style={"height": "500px", "width": "100%"}
    )
])

if __name__ == '__main__':
    app.run(debug=True)

Parsing sequence files

seqviz deprecated its in-browser file / accession props. Parse records in Python instead with dash_seqviz.parse() and spread the result into the component:

from dash_seqviz import SeqViz, parse

props = parse("plasmid.gb")        # FASTA or GenBank; format auto-detected
app.layout = SeqViz(id="viewer", **props)

parse(source, fmt=None, *, record=0, include_translations=True) accepts a file path, an open text handle, or a raw FASTA/GenBank string, and returns {"seq", "name", "annotations", "translations"}. FASTA input yields the sequence and name; GenBank additionally extracts feature annotations and, for CDS features, translations. Requires Biopython (a project dependency).

To pull a record straight from NCBI by accession, use fetch_ncbi(), which fetches a GenBank record and runs it through parse():

from dash_seqviz import SeqViz, fetch_ncbi

props = fetch_ncbi("MN623123.1", email="you@example.com")
SeqViz(id="viewer", **props)

NCBI's E-utilities require a contact email: pass email= or set the NCBI_EMAIL environment variable (an optional api_key= / NCBI_API_KEY raises the rate limit).

Typed inputs & validation

dash_seqviz ships TypedDicts (Annotation, Primer, Highlight, Translation, Enzyme) for editor autocomplete and static type-checking of your element lists, plus a runtime validate_props() helper that raises clear errors (missing keys, start > end, bad direction) before a silent mis-render reaches the browser:

from dash_seqviz import Annotation, validate_props

anns: list[Annotation] = [{"start": 0, "end": 22, "name": "promoter", "direction": 1}]
validate_props(annotations=anns)   # raises ValueError on the first problem

Annotation legend

dash_seqviz.legend(annotations, theme=..., colors=...) returns a Dash layout (html.Div of swatch + name rows) whose colors match what the viewer renders for the same annotations and theme:

from dash import html
from dash_seqviz import SeqViz, legend

anns = [{"start": 0, "end": 20, "name": "promoter", "direction": 1}]
html.Div([
    SeqViz(id="v", seq=seq, annotations=anns, theme="okabe-ito-light"),
    legend(anns, theme="okabe-ito-light", title="Features"),
])

Per-annotation colors win; otherwise swatches follow the same palette the viewer uses (theme palette, or seqviz's default cycle). Supports direction="horizontal", a title, and an id for callbacks — pair it with the viewer's clicked_element prop to highlight the clicked feature.

Exporting figures (SVG / PNG)

Export the current viewer as a publication-ready figure. Set export_request to {"format": "svg" | "png", "token": <changing>, "scale"?: <n>}; the component serializes the live viewer (theme and colors preserved) and returns a data URI in the read-only export_result prop, which you can wire to a download link:

from dash import Dash, Input, Output, ctx, html
from dash.exceptions import PreventUpdate
from dash_seqviz import SeqViz

@app.callback(Output("viewer", "export_request"),
              Input("svg-btn", "n_clicks"), Input("png-btn", "n_clicks"),
              prevent_initial_call=True)
def request_export(svg_n, png_n):
    fmt = "svg" if ctx.triggered_id == "svg-btn" else "png"
    return {"format": fmt, "token": (svg_n or 0) + (png_n or 0)}

@app.callback(Output("dl", "href"), Output("dl", "download"),
              Input("viewer", "export_result"), prevent_initial_call=True)
def to_download(uri):
    if not uri:
        raise PreventUpdate
    ext = "png" if uri.startswith("data:image/png") else "svg"
    return uri, f"figure.{ext}"

SVG is vector (best for papers/posters); PNG rasterizes at scalex (default 2). A runnable version is in examples/recipes/export_figure.py.

API Reference

SeqViz Properties

Required Properties

  • seq (string): The sequence to render. Can be DNA, RNA, or amino acid sequence.

Optional Properties

  • id (string): The ID used to identify this component in Dash callbacks.

  • name (string): The name of the sequence/plasmid. Shown at the center of the circular viewer.

  • viewer (string): The type and orientation of the sequence viewers.

    • Options: "linear", "circular", "both", "both_flip"
    • Default: "both"
  • annotations (list): Array of annotation objects to render.

    • Each annotation: {"start": int, "end": int, "name": str, "direction"?: int, "color"?: str}
  • primers (list): Array of primer objects to render.

    • Each primer: {"start": int, "end": int, "name": str, "direction": int, "color"?: str}
  • highlights (list): Array of highlight objects.

    • Each highlight: {"start": int, "end": int, "color"?: str}
  • translations (list): Array of translation objects.

    • Each translation: {"start": int, "end": int, "direction": int, "name"?: str, "color"?: str}
  • enzymes (list): Array of restriction enzymes.

    • Can be enzyme names (strings) or custom enzyme objects.
    • Custom enzyme: {"name": str, "rseq": str, "fcut": int, "rcut": int, "color"?: str, "range"?: {"start": int, "end": int}}
  • search (dict): Search configuration object.

    • Format: {"query": str, "mismatch"?: int}
  • selection (dict): Selection state object.

    • Format: {"start": int, "end": int, "clockwise"?: bool}
  • colors (list): Array of colors for annotations, translations, and highlights.

  • bp_colors (dict): Object mapping base pairs or indexes to custom colors.

    • Example: {"A": "#FF0000", "T": "#00FF00", 12: "#0000FF"}
  • style (dict): CSS styles for the outer container div.

    • Example: {"height": "500px", "width": "100%"}
  • zoom (dict): Zoom configuration object.

    • Format: {"linear": int} (0-100)
    • Default: {"linear": 50}
  • show_complement (bool): Whether to show the complement sequence.

    • Default: true
  • rotate_on_scroll (bool): Whether the circular viewer rotates on scroll.

    • Default: true
  • disable_external_fonts (bool): Whether to disable downloading external fonts.

    • Default: false
  • max_seq_length (number): Guard for very long sequences. seqviz's linear viewer renders per-base DOM and can hang the tab on multi-megabase input. When set and the sequence length exceeds it, the component renders a lightweight placeholder instead of mounting the viewer. Omit for no guard. For very long sequences that must render, prefer viewer="circular" (which seqviz renders without per-base DOM above its internal cutoff).

  • aria_label (string): Accessible name for the viewer. seqviz renders an unlabeled SVG, so the component gives its container role="group" with this label (and labels the circular SVG role="img"). Defaults to an auto-generated summary ("Sequence viewer: <name>, <N> bp, <M> annotations"). Note: seqviz provides no keyboard navigation of individual features, so this is screen-reader labeling only.

  • theme (string): Visual theme. The underlying seqviz library hardcodes dark-gray text and ticks tuned for light backgrounds, so on a dark dashboard the annotation labels, index numbers, and ticks lose contrast and effectively disappear. Setting a dark theme activates a bundled CSS override that recolors those elements; the colorblind themes additionally inject a CVD-safe qualitative palette into the colors prop. Per-annotation color values you supply always win.

    Available values:

    • "light" (default) — seqviz default.
    • "dark" — text / ticks / selector recolored for dark backgrounds.
    • "auto" — follow the page's color scheme automatically. Detects data-mantine-color-scheme on <html> (set by a dash-mantine-components theme switch) and updates live when it flips, falling back to the prefers-color-scheme media query. Zero-boilerplate for Mantine dashboards — no callback needed.
    • "okabe-ito-light", "okabe-ito-dark" — Okabe & Ito's 7-color CVD-safe palette. The de facto standard for categorical CVD-safe data visualization.
    • "colorbrewer-light", "colorbrewer-dark" — ColorBrewer Set2 (pastel, naturally light) / Dark2 (saturated, naturally dark). CVD-safe.
    • "tol-light", "tol-dark" — Paul Tol's Bright palette (7 colors engineered for deuteranopia / protanopia / tritanopia distinction).

    Wire this to a theme switcher with a Dash callback — for dash-mantine-components, read the colorScheme and push it through:

    @app.callback(
        Output("seqviz", "theme"),
        Input("mantine-provider", "forceColorScheme"),
    )
    def sync_theme(color_scheme):
        return "dark" if color_scheme == "dark" else "light"
    
  • Deprecated (prefer parsing externally with seqparse):

    • file (string | File): FASTA, GenBank, SnapGene, JBEI, or SBOL file
    • accession (string): NCBI accession-ID
  • Events / Read-only:

    • on_selection (function): Called after selection events; selection returned also via selection
    • on_search (function): Called after search; results returned also via search_results (read-only)
    • clicked_element (dict, read-only): The most recently clicked feature (annotation, primer, enzyme, translation, highlight, or search hit), as {"type", "name", "start", "end", "direction", "id", "color"}. Updates only on feature clicks (bare sequence selections leave it unchanged), so Input("id", "clicked_element") gives clean feature-click events for linked views. (seqviz exposes no hover or center-index callbacks, so those are not available.)

Examples

Basic Sequence Viewer

dash_seqviz.SeqViz(
    seq="ATCGATCGATCGATCG",
    name="Simple Sequence",
    viewer="linear"
)

Advanced Sequence with Annotations

dash_seqviz.SeqViz(
    seq="TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC",
    name="J23100 Promoter",
    viewer="both",
    annotations=[
        {
            "start": 0,
            "end": 22,
            "name": "Strong promoter",
            "direction": 1,
            "color": "blue"
        },
        {
            "start": 23,
            "end": 43,
            "name": "RBS",
            "direction": 1,
            "color": "green"
        }
    ],
    primers=[
        {
            "start": 0,
            "end": 20,
            "name": "Forward Primer",
            "direction": 1,
            "color": "red"
        }
    ],
    highlights=[
        {
            "start": 10,
            "end": 30,
            "color": "yellow"
        }
    ],
    style={"height": "500px", "width": "100%"}
)

With Restriction Enzymes

dash_seqviz.SeqViz(
    seq="GAATTCCTGCAGTTAA",  # Contains EcoRI and PstI sites
    name="Enzyme Test",
    viewer="circular",
    enzymes=["EcoRI", "PstI"],
    style={"height": "400px", "width": "400px"}
)

With Search Functionality

dash_seqviz.SeqViz(
    seq="TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC",
    name="Search Example",
    viewer="both",
    search={
        "query": "GCTAGC",
        "mismatch": 1
    },
    style={"height": "500px", "width": "100%"}
)

Contributing

Contributions are welcome. See CONTRIBUTING.md for local development setup — environment, building the component, running the tests, and previewing the docs site.

Releases are automated with release-please: merges to main update the changelog and version, and CI publishes to PyPI and npm.

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

dash_seqviz-0.5.0.tar.gz (414.4 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

dash_seqviz-0.5.0-py3-none-any.whl (409.0 kB view details)

Uploaded Python 3

File details

Details for the file dash_seqviz-0.5.0.tar.gz.

File metadata

  • Download URL: dash_seqviz-0.5.0.tar.gz
  • Upload date:
  • Size: 414.4 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/6.1.0 CPython/3.13.12

File hashes

Hashes for dash_seqviz-0.5.0.tar.gz
Algorithm Hash digest
SHA256 8f5044387c3f7e57215f148d811303705a47ed3a8ade64da8ef83b2aef0bc8ed
MD5 9caa957047aea9f1c959d136e21e6a61
BLAKE2b-256 3041fe972a02c2005cfeb886b971df54fd1182f0ab32caa1d027680e517ddf2f

See more details on using hashes here.

Provenance

The following attestation bundles were made for dash_seqviz-0.5.0.tar.gz:

Publisher: publish.yml on Full-Spectrum-Analytics/dash-seqviz

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file dash_seqviz-0.5.0-py3-none-any.whl.

File metadata

  • Download URL: dash_seqviz-0.5.0-py3-none-any.whl
  • Upload date:
  • Size: 409.0 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/6.1.0 CPython/3.13.12

File hashes

Hashes for dash_seqviz-0.5.0-py3-none-any.whl
Algorithm Hash digest
SHA256 49a7bf6043965e43ca827ad575892ba11d32407348186dc7778a9d139f17f6cb
MD5 3c9475c4abcab3aed0f3961c212e916a
BLAKE2b-256 e911efbe040b160e05673e5866438b016aca5462e65c4553393c6ebe94257d98

See more details on using hashes here.

Provenance

The following attestation bundles were made for dash_seqviz-0.5.0-py3-none-any.whl:

Publisher: publish.yml on Full-Spectrum-Analytics/dash-seqviz

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

Release history Release notifications | RSS feed

This release

0.5.0 This release

2 files

0.4.0

2 files

0.3.0

2 files

0.2.2

2 files

0.2.1

2 files

0.2.0

2 files

0.1.0

2 files

Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page