Dash SeqViz
Dash SeqViz is a Dash component library that provides a Python wrapper for the SeqViz JavaScript library. SeqViz is a powerful DNA, RNA, and protein sequence visualization tool that supports circular and linear viewers, annotations, primers, restriction enzymes, and more.
Features
- Multiple Viewer Types: Support for linear, circular, and both viewers
- Rich Annotations: Add annotations, primers, highlights, and translations to sequences
- Restriction Enzymes: Visualize restriction enzyme cut sites
- Interactive: Full interactivity including selection, search, and zooming
- Custom Styling: Comprehensive styling options
- Dash Integration: Seamless integration with Dash applications and callbacks
Quick Start
from dash_seqviz import SeqViz
from dash import Dash, html
app = Dash(__name__)
app.layout = html.Div([
SeqViz(
id='my-seqviz',
seq="TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC",
name="J23100",
viewer="both",
annotations=[
{
"start": 0,
"end": 22,
"name": "Strong promoter",
"direction": 1,
"color": "blue"
}
],
style={"height": "500px", "width": "100%"}
)
])
if __name__ == '__main__':
app.run(debug=True)
Parsing sequence files
seqviz deprecated its in-browser file / accession props. Parse records
in Python instead with dash_seqviz.parse() and spread the result into the
component:
from dash_seqviz import SeqViz, parse
props = parse("plasmid.gb") # FASTA or GenBank; format auto-detected
app.layout = SeqViz(id="viewer", **props)
parse(source, fmt=None, *, record=0, include_translations=True) accepts a
file path, an open text handle, or a raw FASTA/GenBank string, and returns
{"seq", "name", "annotations", "translations"}. FASTA input yields the
sequence and name; GenBank additionally extracts feature annotations and,
for CDS features, translations. Requires Biopython (a project dependency).
To pull a record straight from NCBI by accession, use fetch_ncbi(), which
fetches a GenBank record and runs it through parse():
from dash_seqviz import SeqViz, fetch_ncbi
props = fetch_ncbi("MN623123.1", email="you@example.com")
SeqViz(id="viewer", **props)
NCBI's E-utilities require a contact email: pass email= or set the
NCBI_EMAIL environment variable (an optional api_key= / NCBI_API_KEY
raises the rate limit).
Typed inputs & validation
dash_seqviz ships TypedDicts (Annotation, Primer, Highlight,
Translation, Enzyme) for editor autocomplete and static type-checking of
your element lists, plus a runtime validate_props() helper that raises
clear errors (missing keys, start > end, bad direction) before a silent
mis-render reaches the browser:
from dash_seqviz import Annotation, validate_props
anns: list[Annotation] = [{"start": 0, "end": 22, "name": "promoter", "direction": 1}]
validate_props(annotations=anns) # raises ValueError on the first problem
Annotation legend
dash_seqviz.legend(annotations, theme=..., colors=...) returns a Dash
layout (html.Div of swatch + name rows) whose colors match what the viewer
renders for the same annotations and theme:
from dash import html
from dash_seqviz import SeqViz, legend
anns = [{"start": 0, "end": 20, "name": "promoter", "direction": 1}]
html.Div([
SeqViz(id="v", seq=seq, annotations=anns, theme="okabe-ito-light"),
legend(anns, theme="okabe-ito-light", title="Features"),
])
Per-annotation colors win; otherwise swatches follow the same palette the
viewer uses (theme palette, or seqviz's default cycle). Supports
direction="horizontal", a title, and an id for callbacks — pair it with
the viewer's clicked_element prop to highlight the clicked feature.
Exporting figures (SVG / PNG)
Export the current viewer as a publication-ready figure. Set export_request
to {"format": "svg" | "png", "token": <changing>, "scale"?: <n>}; the
component serializes the live viewer (theme and colors preserved) and returns
a data URI in the read-only export_result prop, which you can wire to a
download link:
from dash import Dash, Input, Output, ctx, html
from dash.exceptions import PreventUpdate
from dash_seqviz import SeqViz
@app.callback(Output("viewer", "export_request"),
Input("svg-btn", "n_clicks"), Input("png-btn", "n_clicks"),
prevent_initial_call=True)
def request_export(svg_n, png_n):
fmt = "svg" if ctx.triggered_id == "svg-btn" else "png"
return {"format": fmt, "token": (svg_n or 0) + (png_n or 0)}
@app.callback(Output("dl", "href"), Output("dl", "download"),
Input("viewer", "export_result"), prevent_initial_call=True)
def to_download(uri):
if not uri:
raise PreventUpdate
ext = "png" if uri.startswith("data:image/png") else "svg"
return uri, f"figure.{ext}"
SVG is vector (best for papers/posters); PNG rasterizes at scalex (default
2). A runnable version is in
examples/recipes/export_figure.py.
API Reference
SeqViz Properties
Required Properties
seq(string): The sequence to render. Can be DNA, RNA, or amino acid sequence.
Optional Properties
-
id(string): The ID used to identify this component in Dash callbacks. -
name(string): The name of the sequence/plasmid. Shown at the center of the circular viewer. -
viewer(string): The type and orientation of the sequence viewers.- Options:
"linear","circular","both","both_flip" - Default:
"both"
- Options:
-
annotations(list): Array of annotation objects to render.- Each annotation:
{"start": int, "end": int, "name": str, "direction"?: int, "color"?: str}
- Each annotation:
-
primers(list): Array of primer objects to render.- Each primer:
{"start": int, "end": int, "name": str, "direction": int, "color"?: str}
- Each primer:
-
highlights(list): Array of highlight objects.- Each highlight:
{"start": int, "end": int, "color"?: str}
- Each highlight:
-
translations(list): Array of translation objects.- Each translation:
{"start": int, "end": int, "direction": int, "name"?: str, "color"?: str}
- Each translation:
-
enzymes(list): Array of restriction enzymes.- Can be enzyme names (strings) or custom enzyme objects.
- Custom enzyme:
{"name": str, "rseq": str, "fcut": int, "rcut": int, "color"?: str, "range"?: {"start": int, "end": int}}
-
search(dict): Search configuration object.- Format:
{"query": str, "mismatch"?: int}
- Format:
-
selection(dict): Selection state object.- Format:
{"start": int, "end": int, "clockwise"?: bool}
- Format:
-
colors(list): Array of colors for annotations, translations, and highlights. -
bp_colors(dict): Object mapping base pairs or indexes to custom colors.- Example:
{"A": "#FF0000", "T": "#00FF00", 12: "#0000FF"}
- Example:
-
style(dict): CSS styles for the outer container div.- Example:
{"height": "500px", "width": "100%"}
- Example:
-
zoom(dict): Zoom configuration object.- Format:
{"linear": int}(0-100) - Default:
{"linear": 50}
- Format:
-
show_complement(bool): Whether to show the complement sequence.- Default:
true
- Default:
-
rotate_on_scroll(bool): Whether the circular viewer rotates on scroll.- Default:
true
- Default:
-
disable_external_fonts(bool): Whether to disable downloading external fonts.- Default:
false
- Default:
-
max_seq_length(number): Guard for very long sequences. seqviz's linear viewer renders per-base DOM and can hang the tab on multi-megabase input. When set and the sequence length exceeds it, the component renders a lightweight placeholder instead of mounting the viewer. Omit for no guard. For very long sequences that must render, preferviewer="circular"(which seqviz renders without per-base DOM above its internal cutoff). -
aria_label(string): Accessible name for the viewer. seqviz renders an unlabeled SVG, so the component gives its containerrole="group"with this label (and labels the circular SVGrole="img"). Defaults to an auto-generated summary ("Sequence viewer: <name>, <N> bp, <M> annotations"). Note: seqviz provides no keyboard navigation of individual features, so this is screen-reader labeling only. -
theme(string): Visual theme. The underlying seqviz library hardcodes dark-gray text and ticks tuned for light backgrounds, so on a dark dashboard the annotation labels, index numbers, and ticks lose contrast and effectively disappear. Setting a dark theme activates a bundled CSS override that recolors those elements; the colorblind themes additionally inject a CVD-safe qualitative palette into thecolorsprop. Per-annotationcolorvalues you supply always win.Available values:
"light"(default) — seqviz default."dark"— text / ticks / selector recolored for dark backgrounds."auto"— follow the page's color scheme automatically. Detectsdata-mantine-color-schemeon<html>(set by a dash-mantine-components theme switch) and updates live when it flips, falling back to theprefers-color-schememedia query. Zero-boilerplate for Mantine dashboards — no callback needed."okabe-ito-light","okabe-ito-dark"— Okabe & Ito's 7-color CVD-safe palette. The de facto standard for categorical CVD-safe data visualization."colorbrewer-light","colorbrewer-dark"— ColorBrewer Set2 (pastel, naturally light) / Dark2 (saturated, naturally dark). CVD-safe."tol-light","tol-dark"— Paul Tol's Bright palette (7 colors engineered for deuteranopia / protanopia / tritanopia distinction).
Wire this to a theme switcher with a Dash callback — for dash-mantine-components, read the colorScheme and push it through:
@app.callback( Output("seqviz", "theme"), Input("mantine-provider", "forceColorScheme"), ) def sync_theme(color_scheme): return "dark" if color_scheme == "dark" else "light"
-
Deprecated (prefer parsing externally with
seqparse):file(string | File): FASTA, GenBank, SnapGene, JBEI, or SBOL fileaccession(string): NCBI accession-ID
-
Events / Read-only:
on_selection(function): Called after selection events; selection returned also viaselectionon_search(function): Called after search; results returned also viasearch_results(read-only)clicked_element(dict, read-only): The most recently clicked feature (annotation, primer, enzyme, translation, highlight, or search hit), as{"type", "name", "start", "end", "direction", "id", "color"}. Updates only on feature clicks (bare sequence selections leave it unchanged), soInput("id", "clicked_element")gives clean feature-click events for linked views. (seqviz exposes no hover or center-index callbacks, so those are not available.)
Examples
Basic Sequence Viewer
dash_seqviz.SeqViz(
seq="ATCGATCGATCGATCG",
name="Simple Sequence",
viewer="linear"
)
Advanced Sequence with Annotations
dash_seqviz.SeqViz(
seq="TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC",
name="J23100 Promoter",
viewer="both",
annotations=[
{
"start": 0,
"end": 22,
"name": "Strong promoter",
"direction": 1,
"color": "blue"
},
{
"start": 23,
"end": 43,
"name": "RBS",
"direction": 1,
"color": "green"
}
],
primers=[
{
"start": 0,
"end": 20,
"name": "Forward Primer",
"direction": 1,
"color": "red"
}
],
highlights=[
{
"start": 10,
"end": 30,
"color": "yellow"
}
],
style={"height": "500px", "width": "100%"}
)
With Restriction Enzymes
dash_seqviz.SeqViz(
seq="GAATTCCTGCAGTTAA", # Contains EcoRI and PstI sites
name="Enzyme Test",
viewer="circular",
enzymes=["EcoRI", "PstI"],
style={"height": "400px", "width": "400px"}
)
With Search Functionality
dash_seqviz.SeqViz(
seq="TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC",
name="Search Example",
viewer="both",
search={
"query": "GCTAGC",
"mismatch": 1
},
style={"height": "500px", "width": "100%"}
)
Contributing
Contributions are welcome. See CONTRIBUTING.md for local development setup — environment, building the component, running the tests, and previewing the docs site.
- Docs & live explorer: https://dash-seqviz.com
- Source, issues & PRs: https://github.com/Full-Spectrum-Analytics/dash-seqviz
Releases are automated with
release-please: merges to
main update the changelog and version, and CI publishes to PyPI and npm.
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file dash_seqviz-0.4.0.tar.gz.
File metadata
- Download URL: dash_seqviz-0.4.0.tar.gz
- Upload date:
- Size: 387.3 kB
- Tags: Source
- Uploaded using Trusted Publishing? Yes
- Uploaded via:
twine/6.1.0 CPython/3.13.12
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
beff1afb3fc6d2fd1aeb245e752b35fe5ea3d3b838695680179c13aa3600357e
|
|
| MD5 |
f3e7a8edfbe949b7d128838a10fbb428
|
|
| BLAKE2b-256 |
891250e1bf87126fc3bdb1783b628dc3786118894aac9a88047c61aa5e2858aa
|
Provenance
The following attestation bundles were made for dash_seqviz-0.4.0.tar.gz:
Publisher:
publish.yml on Full-Spectrum-Analytics/dash-seqviz
-
Statement:
-
Statement type:
https://in-toto.io/Statement/v1 -
Predicate type:
https://docs.pypi.org/attestations/publish/v1 -
Subject name:
dash_seqviz-0.4.0.tar.gz -
Subject digest:
beff1afb3fc6d2fd1aeb245e752b35fe5ea3d3b838695680179c13aa3600357e - Sigstore transparency entry: 2168479462
- Sigstore integration time:
-
Permalink:
Full-Spectrum-Analytics/dash-seqviz@7f4bd6452b6075b63bd6eea1be2f5026a490a161 -
Branch / Tag:
refs/heads/main - Owner: https://github.com/Full-Spectrum-Analytics
-
Access:
public
-
Token Issuer:
https://token.actions.githubusercontent.com -
Runner Environment:
github-hosted -
Publication workflow:
publish.yml@7f4bd6452b6075b63bd6eea1be2f5026a490a161 -
Trigger Event:
workflow_dispatch
-
Statement type:
File details
Details for the file dash_seqviz-0.4.0-py3-none-any.whl.
File metadata
- Download URL: dash_seqviz-0.4.0-py3-none-any.whl
- Upload date:
- Size: 384.0 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? Yes
- Uploaded via:
twine/6.1.0 CPython/3.13.12
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
4fd244968cc3544c34a027ccdbad1e1e3a74f830852726ca6311d55eded7f557
|
|
| MD5 |
f1f74a5fc9b9f4608e8cf5d4b1ea1594
|
|
| BLAKE2b-256 |
eac4cf7a32a443c634c0894f8696d65000b7b6f7825fbe77ed4f09b3ead34e39
|
Provenance
The following attestation bundles were made for dash_seqviz-0.4.0-py3-none-any.whl:
Publisher:
publish.yml on Full-Spectrum-Analytics/dash-seqviz
-
Statement:
-
Statement type:
https://in-toto.io/Statement/v1 -
Predicate type:
https://docs.pypi.org/attestations/publish/v1 -
Subject name:
dash_seqviz-0.4.0-py3-none-any.whl -
Subject digest:
4fd244968cc3544c34a027ccdbad1e1e3a74f830852726ca6311d55eded7f557 - Sigstore transparency entry: 2168479513
- Sigstore integration time:
-
Permalink:
Full-Spectrum-Analytics/dash-seqviz@7f4bd6452b6075b63bd6eea1be2f5026a490a161 -
Branch / Tag:
refs/heads/main - Owner: https://github.com/Full-Spectrum-Analytics
-
Access:
public
-
Token Issuer:
https://token.actions.githubusercontent.com -
Runner Environment:
github-hosted -
Publication workflow:
publish.yml@7f4bd6452b6075b63bd6eea1be2f5026a490a161 -
Trigger Event:
workflow_dispatch
-
Statement type: