deepmirt 1.0.0

DeepMiRT: miRNA target prediction using RNA foundation models and cross-attention

DeepMiRT

miRNA Target Prediction with RNA Foundation Models

DeepMiRT predicts miRNA-target interactions using RNA-FM embeddings and cross-attention, ranking #1 on eCLIP benchmarks among 12 methods.

---

Why DeepMiRT?

Existing miRNA target prediction tools rely on hand-crafted thermodynamic rules or shallow sequence features, struggling to capture the full complexity of miRNA-target recognition. DeepMiRT addresses this by leveraging RNA-FM, a foundation model pre-trained on 23 million non-coding RNAs, as a shared encoder for both miRNA and target. A cross-attention mechanism then lets the target "read" the miRNA to learn complementarity patterns beyond simple seed matching. The result: state-of-the-art performance, ranking #1 among 12 methods on eCLIP benchmarks and achieving 0.96 AUROC on a held-out test set of 813K samples.

Key Results at a Glance

0.96 AUROC

#1 / 12 eCLIP Benchmark

813K Test Samples

3-line Python API

Quick Start

pip install deepmirt

from deepmirt import predict

probs = predict(
    mirna_seqs=["UGAGGUAGUAGGUUGUAUAGUU"],
    target_seqs=["ACUGCAGCAUAUCUACUAUUUGCUACUGUAACCAUUGAUCU"],
)
print(f"Interaction probability: {probs[0]:.4f}")

Model weights are automatically downloaded from Hugging Face Hub on first use (~495 MB).

Architecture

graph LR
    A["miRNA<br/>(18-25 nt)"] --> B["RNA-FM<br/>Encoder"]
    C["Target<br/>(40 nt)"] --> D["RNA-FM<br/>Encoder"]
    B --> E["miRNA Embedding<br/>(B, M, 640)"]
    D --> F["Target Embedding<br/>(B, T, 640)"]
    E --> G["Cross-Attention<br/>(2 layers, 8 heads)"]
    F --> G
    G --> H["Masked Mean Pool"]
    H --> I["MLP Head<br/>640 → 256 → 64 → 1"]
    I --> J["Probability"]

    style B fill:#4a90d9,color:#fff
    style D fill:#4a90d9,color:#fff
    style G fill:#e67e22,color:#fff
    style I fill:#27ae60,color:#fff

The model uses a shared RNA-FM encoder for both sequences, ensuring they lie in the same representation space. Cross-attention lets the target "read" the miRNA to capture complementarity and binding signals. Two-phase training first optimizes the classifier (frozen backbone), then fine-tunes the top 3 RNA-FM layers.

ASCII diagram (fallback)

miRNA  (18-25 nt) ──→ [RNA-FM Encoder] ──→ miRNA embedding (B, M, 640) ──────────┐
                        (shared weights)                                           ↓
Target (40 nt)    ──→ [RNA-FM Encoder] ──→ target embedding (B, T, 640) → [Cross-Attention]
                                                                                   ↓
                                                                          Masked Mean Pool
                                                                                   ↓
                                                                              [MLP Head]
                                                                           640 → 256 → 64 → 1
                                                                                   ↓
                                                                             probability

Genome-Wide Target Scanning

DeepMiRT can scan entire 3'UTR or transcript sequences to identify binding sites genome-wide -- similar to miRanda, but powered by the deep learning model.

Python API

from deepmirt import scan_targets

results = scan_targets(
    mirna_fasta="mirnas.fa",           # or dict: {"let-7": "UGAGGUAGUAGGUUGUAUAGUU"}
    target_fasta="3utrs.fa",
    output_prefix="results/scan",      # writes _details.txt, _hits.tsv, _summary.tsv
    device="cuda",
    scan_mode="hybrid",                # "seed" | "hybrid" | "exhaustive"
    prob_threshold=0.5,
)

for r in results:
    for hit in r.hits:
        print(f"{r.target_id} pos={hit.position} prob={hit.probability:.3f} ({hit.seed_type})")

Command Line

# Scan with a FASTA of miRNAs against target 3'UTRs
deepmirt-predict scan \
    --mirna-fasta mirnas.fa \
    --target-fasta 3utrs.fa \
    --output results/scan \
    --device cuda \
    --scan-mode hybrid \
    --threshold 0.5

# Scan with a single miRNA sequence
deepmirt-predict scan \
    --mirna UGAGGUAGUAGGUUGUAUAGUU \
    --mirna-id dme-let-7 \
    --target-fasta 3utrs.fa \
    --output results/scan \
    --device cpu

Scanning Modes

Mode	Strategy	Speed	Use Case
seed	Only score seed match positions (8mer/7mer/6mer)	Fastest	Quick screen, high-confidence sites
hybrid	Seed matches + sliding window (stride=20) to fill gaps	Default	Balanced: catches seed + non-canonical sites
exhaustive	Sliding window across entire target	Slowest	Comprehensive, catches everything

Output Files

File	Description
{prefix}_details.txt	Human-readable report with ASCII alignment for each hit
{prefix}_hits.tsv	Per-hit table: position, probability, seed type, window sequence
{prefix}_summary.tsv	Per-target summary: number of hits, max/mean probability

Example alignment from _details.txt:

Scanning: dme-miR-1-3p vs FBTR0082186_3UTR (1247 nt)
  Hits found: 2

  Hit at position 617, Prob: 0.8923, Seed: 7mer-m8

    miRNA  3' ...uauCCGCGGCCggg... 5'
                  ||||||||::
    Target 5' ...aGGCGCCGGAact... 3'

Installation

From PyPI

pip install deepmirt

From source (for development)

git clone https://github.com/zichengll/DeepMiRT.git
cd DeepMiRT
pip install -e ".[dev,eval]"

Requirements

• Python >= 3.9
• PyTorch >= 1.12
• RNA-FM (rna-fm package)
• ~495 MB disk space for model weights (auto-downloaded)

Usage

Python API

from deepmirt import predict

# Single pair
probs = predict(
    mirna_seqs=["UGAGGUAGUAGGUUGUAUAGUU"],
    target_seqs=["ACUGCAGCAUAUCUACUAUUUGCUACUGUAACCAUUGAUCU"],
)

# Multiple pairs
probs = predict(
    mirna_seqs=["UGAGGUAGUAGGUUGUAUAGUU", "UAGCAGCACGUAAAUAUUGGCG"],
    target_seqs=["ACUGCAGCAUAUCUACUAUUUGCUACUGUAACCAUUGAUCU",
                 "GCAAUGUUUUCCACAGUGCUUACACAGAAAUAGCAACUUUA"],
    device="cuda",  # use GPU if available
)

CSV Batch Prediction

from deepmirt.predict import predict_from_csv

df = predict_from_csv(
    csv_path="input.csv",         # must have mirna_seq and target_seq columns
    output_path="results.csv",
    device="cpu",
)

Command Line

# Single pair
deepmirt-predict single --mirna UGAGGUAGUAGGUUGUAUAGUU \
    --target ACUGCAGCAUAUCUACUAUUUGCUACUGUAACCAUUGAUCU

# Batch from CSV
deepmirt-predict batch --input data.csv --output results.csv --device cuda

Input Format

• miRNA sequences: 18-25 nt, DNA (T) or RNA (U) format
• Target sequences: 40 nt recommended (the model was trained on 40-nt target site fragments)
• Sequences are automatically converted to RNA format internally

Web Demo

Try DeepMiRT without installation: huggingface.co/spaces/liuliu2333/deepmirt

The demo supports single-pair prediction with pre-loaded examples and batch CSV upload.

Benchmark Results

Standard Benchmark: miRBench eCLIP Datasets

DeepMiRT ranks #1 on both eCLIP benchmark datasets from miRBench (fair comparison -- all methods evaluated on the same held-out data by the benchmark authors):

Method	Type	eCLIP Klimentova 2022	eCLIP Manakov 2022
DeepMiRT (ours)	DL + LM	0.7511	0.7543
TargetScanCnn	CNN	0.7138	0.7205
miRBind	DL	0.7004	--
miRNA_CNN	CNN	0.6981	--
RNACofold	Thermo.	--	0.6841

Standard Benchmark: miRBench CLASH Dataset

On the CLASH dataset, DeepMiRT ranks #5 (honest reporting -- CLASH captures different biology):

Method	AUROC
miRBind	0.7649
miRNA_CNN	0.7614
InteractionAwareModel	0.7510
RNACofold	0.7455
DeepMiRT (ours)	0.6952

Our Test Set (813K samples)

Method	Type	AUROC	AUPRC	F1	MCC
DeepMiRT (ours)	DL + LM	0.9606	0.9669	0.8949	0.8111
TargetScanCnn	CNN	0.8856	0.8999	0.8449	0.7197
Seed Match	Rule	0.8817	0.8585	0.8719	0.7726
miRanda	Complement + MFE	0.7688	0.7168	0.7813	0.5858
miRBind	DL	0.7641	0.7446	0.7012	0.3723
RNAhybrid	MFE	0.7230	0.7079	0.6673	0.3406

Full comparison table (16 methods)

Method	Type	AUROC	AUPRC	F1	MCC	Sensitivity	Specificity
DeepMiRT (ours)	DL + LM	0.9606	0.9669	0.8949	0.8111	0.8396	0.9641
TargetScanCnn	CNN	0.8856	0.8999	0.8449	0.7197	0.7944	0.9182
Seed Match	Rule	0.8817	0.8585	0.8719	0.7726	0.8098	0.9535
Seed6mer	Rule	0.8670	0.8241	0.8592	0.7374	0.8263	0.9077
Seed7mer	Rule	0.7802	0.7619	0.7268	0.6118	0.5865	0.9740
miRanda	Complement + MFE	0.7688	0.7168	0.7813	0.5858	0.7420	0.8410
miRBind	DL	0.7641	0.7446	0.7012	0.3723	0.7659	0.6021
miRNA_CNN	CNN	0.7299	0.7200	0.6555	0.3543	0.6296	0.7229
RNAhybrid	MFE	0.7230	0.7079	0.6673	0.3406	0.6582	0.6823
Seed8mer	Rule	0.6624	0.6785	0.4534	0.4254	0.2963	0.9938
Seed6merBulge	Rule	0.6455	0.6313	0.6050	0.2878	0.5718	0.7147
CnnMirTarget	CNN	0.5830	0.5793	0.5362	0.0910	0.5025	0.5879
TargetNet	DL	0.4972	0.4980	0.4712	-0.0080	0.4583	0.5333
Random	--	0.5000	0.5005	0.4896	-0.0014	0.4960	0.5026

Note: DeepMiRT excels at target site identification (eCLIP-type tasks) but is less suited for distinguishing competitive binding among multiple miRNAs at the same target site (CLASH-type tasks).

Training your own model

Training

# Phase 1: Frozen backbone
python deepmirt/training/train.py \
    --config deepmirt/configs/default.yaml

# Phase 2: Unfreeze top 3 layers (edit config or use overrides)
python deepmirt/training/train.py \
    --config deepmirt/configs/default.yaml \
    --override unfreezing.enabled=true model.freeze_backbone=false \
    --ckpt checkpoints/best-phase1.ckpt

See deepmirt/configs/default.yaml for all configurable hyperparameters.

Project structure

Project Structure

DeepMiRT/
├── deepmirt/
│   ├── model/              # Neural network modules
│   │   ├── mirna_target_model.py   # Full model: RNA-FM + CrossAttn + MLP
│   │   ├── rnafm_encoder.py        # RNA-FM wrapper with freeze/unfreeze
│   │   ├── cross_attention.py      # Multi-layer cross-attention block
│   │   └── classifier.py           # MLP classification head
│   ├── training/           # PyTorch Lightning training
│   │   ├── lightning_module.py     # LightningModule with metrics
│   │   ├── train.py               # Training entry point
│   │   └── callbacks.py           # Staged unfreezing callback
│   ├── data_module/        # Data loading and preprocessing
│   ├── evaluation/         # 9-step evaluation pipeline
│   ├── scanning/           # Genome-wide target site scanning
│   │   ├── scanner.py             # Core TargetScanner class
│   │   ├── site_finder.py         # Seed match finder
│   │   └── output_formatter.py    # TXT/TSV output formatters
│   ├── configs/            # YAML configuration files
│   ├── predict.py          # Public prediction & scanning API
│   └── tests/              # Unit tests
├── app.py                  # Gradio web demo
├── examples/               # Usage examples
└── docs/                   # Figures and documentation

Contributing

Contributions are welcome. Please open an issue first to discuss what you would like to change.

1. Fork the repository
2. Create a feature branch (git checkout -b feature/my-feature)
3. Install dev dependencies: pip install -e ".[dev]"
4. Run tests: pytest deepmirt/tests/
5. Open a pull request

Citation

@software{liu2026deepmirt,
  title={DeepMiRT: miRNA Target Prediction with RNA Foundation Models},
  author={Liu, Zicheng},
  year={2026},
  url={https://github.com/zichengll/DeepMiRT}
}

License

This project is licensed under the MIT License.

Acknowledgments

• RNA-FM -- pre-trained RNA foundation model (Chen et al., 2022)
• miRBench -- standardized benchmark framework (Gresova et al.)
• PyTorch Lightning -- training framework
• Hugging Face -- model hosting and demo platform