Skip to main content

DeepMiRT: miRNA target prediction using RNA foundation models and cross-attention

Project description

DeepMiRT

miRNA Target Prediction with RNA Foundation Models

PyPI HF Model HF Demo License: MIT Python 3.9+ AUROC 0.96

DeepMiRT predicts miRNA-target interactions using RNA-FM embeddings and cross-attention, ranking #1 on eCLIP benchmarks among 12 methods.


Why DeepMiRT?

Existing miRNA target prediction tools rely on hand-crafted thermodynamic rules or shallow sequence features, struggling to capture the full complexity of miRNA-target recognition. DeepMiRT addresses this by leveraging RNA-FM, a foundation model pre-trained on 23 million non-coding RNAs, as a shared encoder for both miRNA and target. A cross-attention mechanism then lets the target "read" the miRNA to learn complementarity patterns beyond simple seed matching. The result: state-of-the-art performance, ranking #1 among 12 methods on eCLIP benchmarks and achieving 0.96 AUROC on a held-out test set of 813K samples.

Key Results at a Glance

0.96
AUROC
#1 / 12
eCLIP Benchmark
813K
Test Samples
3-line
Python API

Quick Start

pip install deepmirt
from deepmirt import predict

probs = predict(
    mirna_seqs=["UGAGGUAGUAGGUUGUAUAGUU"],
    target_seqs=["ACUGCAGCAUAUCUACUAUUUGCUACUGUAACCAUUGAUCU"],
)
print(f"Interaction probability: {probs[0]:.4f}")

Model weights are automatically downloaded from Hugging Face Hub on first use (~495 MB).

Architecture

graph LR
    A["miRNA<br/>(18-25 nt)"] --> B["RNA-FM<br/>Encoder"]
    C["Target<br/>(40 nt)"] --> D["RNA-FM<br/>Encoder"]
    B --> E["miRNA Embedding<br/>(B, M, 640)"]
    D --> F["Target Embedding<br/>(B, T, 640)"]
    E --> G["Cross-Attention<br/>(2 layers, 8 heads)"]
    F --> G
    G --> H["Masked Mean Pool"]
    H --> I["MLP Head<br/>640 → 256 → 64 → 1"]
    I --> J["Probability"]

    style B fill:#4a90d9,color:#fff
    style D fill:#4a90d9,color:#fff
    style G fill:#e67e22,color:#fff
    style I fill:#27ae60,color:#fff

The model uses a shared RNA-FM encoder for both sequences, ensuring they lie in the same representation space. Cross-attention lets the target "read" the miRNA to capture complementarity and binding signals. Two-phase training first optimizes the classifier (frozen backbone), then fine-tunes the top 3 RNA-FM layers.

ASCII diagram (fallback)
miRNA  (18-25 nt) ──→ [RNA-FM Encoder] ──→ miRNA embedding (B, M, 640) ──────────┐
                        (shared weights)                                           ↓
Target (40 nt)    ──→ [RNA-FM Encoder] ──→ target embedding (B, T, 640) → [Cross-Attention]
                                                                                   ↓
                                                                          Masked Mean Pool
                                                                                   ↓
                                                                              [MLP Head]
                                                                           640 → 256 → 64 → 1
                                                                                   ↓
                                                                             probability

Genome-Wide Target Scanning

DeepMiRT can scan entire 3'UTR or transcript sequences to identify binding sites genome-wide -- similar to miRanda, but powered by the deep learning model.

Python API

from deepmirt import scan_targets

results = scan_targets(
    mirna_fasta="mirnas.fa",           # or dict: {"let-7": "UGAGGUAGUAGGUUGUAUAGUU"}
    target_fasta="3utrs.fa",
    output_prefix="results/scan",      # writes _details.txt, _hits.tsv, _summary.tsv
    device="cuda",
    scan_mode="hybrid",                # "seed" | "hybrid" | "exhaustive"
    prob_threshold=0.5,
)

for r in results:
    for hit in r.hits:
        print(f"{r.target_id} pos={hit.position} prob={hit.probability:.3f} ({hit.seed_type})")

Command Line

# Scan with a FASTA of miRNAs against target 3'UTRs
deepmirt-predict scan \
    --mirna-fasta mirnas.fa \
    --target-fasta 3utrs.fa \
    --output results/scan \
    --device cuda \
    --scan-mode hybrid \
    --threshold 0.5

# Scan with a single miRNA sequence
deepmirt-predict scan \
    --mirna UGAGGUAGUAGGUUGUAUAGUU \
    --mirna-id dme-let-7 \
    --target-fasta 3utrs.fa \
    --output results/scan \
    --device cpu

Scanning Modes

Mode Strategy Speed Use Case
seed Only score seed match positions (8mer/7mer/6mer) Fastest Quick screen, high-confidence sites
hybrid Seed matches + sliding window (stride=20) to fill gaps Default Balanced: catches seed + non-canonical sites
exhaustive Sliding window across entire target Slowest Comprehensive, catches everything

Output Files

File Description
{prefix}_details.txt Human-readable report with ASCII alignment for each hit
{prefix}_hits.tsv Per-hit table: position, probability, seed type, window sequence
{prefix}_summary.tsv Per-target summary: number of hits, max/mean probability

Example alignment from _details.txt:

Scanning: dme-miR-1-3p vs FBTR0082186_3UTR (1247 nt)
  Hits found: 2

  Hit at position 617, Prob: 0.8923, Seed: 7mer-m8

    miRNA  3' ...uauCCGCGGCCggg... 5'
                  ||||||||::
    Target 5' ...aGGCGCCGGAact... 3'

Installation

From PyPI

pip install deepmirt

From source (for development)

git clone https://github.com/zichengll/DeepMiRT.git
cd DeepMiRT
pip install -e ".[dev,eval]"

Requirements

  • Python >= 3.9
  • PyTorch >= 1.12
  • RNA-FM (rna-fm package)
  • ~495 MB disk space for model weights (auto-downloaded)

Usage

Python API

from deepmirt import predict

# Single pair
probs = predict(
    mirna_seqs=["UGAGGUAGUAGGUUGUAUAGUU"],
    target_seqs=["ACUGCAGCAUAUCUACUAUUUGCUACUGUAACCAUUGAUCU"],
)

# Multiple pairs
probs = predict(
    mirna_seqs=["UGAGGUAGUAGGUUGUAUAGUU", "UAGCAGCACGUAAAUAUUGGCG"],
    target_seqs=["ACUGCAGCAUAUCUACUAUUUGCUACUGUAACCAUUGAUCU",
                 "GCAAUGUUUUCCACAGUGCUUACACAGAAAUAGCAACUUUA"],
    device="cuda",  # use GPU if available
)

CSV Batch Prediction

from deepmirt.predict import predict_from_csv

df = predict_from_csv(
    csv_path="input.csv",         # must have mirna_seq and target_seq columns
    output_path="results.csv",
    device="cpu",
)

Command Line

# Single pair
deepmirt-predict single --mirna UGAGGUAGUAGGUUGUAUAGUU \
    --target ACUGCAGCAUAUCUACUAUUUGCUACUGUAACCAUUGAUCU

# Batch from CSV
deepmirt-predict batch --input data.csv --output results.csv --device cuda

Input Format

  • miRNA sequences: 18-25 nt, DNA (T) or RNA (U) format
  • Target sequences: 40 nt recommended (the model was trained on 40-nt target site fragments)
  • Sequences are automatically converted to RNA format internally

Web Demo

Try DeepMiRT without installation: huggingface.co/spaces/liuliu2333/deepmirt

The demo supports single-pair prediction with pre-loaded examples and batch CSV upload.

Benchmark Results

Standard Benchmark: miRBench eCLIP Datasets

DeepMiRT ranks #1 on both eCLIP benchmark datasets from miRBench (fair comparison -- all methods evaluated on the same held-out data by the benchmark authors):

Method Type eCLIP Klimentova 2022 eCLIP Manakov 2022
DeepMiRT (ours) DL + LM 0.7511 0.7543
TargetScanCnn CNN 0.7138 0.7205
miRBind DL 0.7004 --
miRNA_CNN CNN 0.6981 --
RNACofold Thermo. -- 0.6841

Standard Benchmark: miRBench CLASH Dataset

On the CLASH dataset, DeepMiRT ranks #5 (honest reporting -- CLASH captures different biology):

Method AUROC
miRBind 0.7649
miRNA_CNN 0.7614
InteractionAwareModel 0.7510
RNACofold 0.7455
DeepMiRT (ours) 0.6952

Our Test Set (813K samples)

Method Type AUROC AUPRC F1 MCC
DeepMiRT (ours) DL + LM 0.9606 0.9669 0.8949 0.8111
TargetScanCnn CNN 0.8856 0.8999 0.8449 0.7197
Seed Match Rule 0.8817 0.8585 0.8719 0.7726
miRanda Complement + MFE 0.7688 0.7168 0.7813 0.5858
miRBind DL 0.7641 0.7446 0.7012 0.3723
RNAhybrid MFE 0.7230 0.7079 0.6673 0.3406
Full comparison table (16 methods)
Method Type AUROC AUPRC F1 MCC Sensitivity Specificity
DeepMiRT (ours) DL + LM 0.9606 0.9669 0.8949 0.8111 0.8396 0.9641
TargetScanCnn CNN 0.8856 0.8999 0.8449 0.7197 0.7944 0.9182
Seed Match Rule 0.8817 0.8585 0.8719 0.7726 0.8098 0.9535
Seed6mer Rule 0.8670 0.8241 0.8592 0.7374 0.8263 0.9077
Seed7mer Rule 0.7802 0.7619 0.7268 0.6118 0.5865 0.9740
miRanda Complement + MFE 0.7688 0.7168 0.7813 0.5858 0.7420 0.8410
miRBind DL 0.7641 0.7446 0.7012 0.3723 0.7659 0.6021
miRNA_CNN CNN 0.7299 0.7200 0.6555 0.3543 0.6296 0.7229
RNAhybrid MFE 0.7230 0.7079 0.6673 0.3406 0.6582 0.6823
Seed8mer Rule 0.6624 0.6785 0.4534 0.4254 0.2963 0.9938
Seed6merBulge Rule 0.6455 0.6313 0.6050 0.2878 0.5718 0.7147
CnnMirTarget CNN 0.5830 0.5793 0.5362 0.0910 0.5025 0.5879
TargetNet DL 0.4972 0.4980 0.4712 -0.0080 0.4583 0.5333
Random -- 0.5000 0.5005 0.4896 -0.0014 0.4960 0.5026

Benchmark Comparison

Note: DeepMiRT excels at target site identification (eCLIP-type tasks) but is less suited for distinguishing competitive binding among multiple miRNAs at the same target site (CLASH-type tasks).

Training your own model

Training

# Phase 1: Frozen backbone
python deepmirt/training/train.py \
    --config deepmirt/configs/default.yaml

# Phase 2: Unfreeze top 3 layers (edit config or use overrides)
python deepmirt/training/train.py \
    --config deepmirt/configs/default.yaml \
    --override unfreezing.enabled=true model.freeze_backbone=false \
    --ckpt checkpoints/best-phase1.ckpt

See deepmirt/configs/default.yaml for all configurable hyperparameters.

Project structure

Project Structure

DeepMiRT/
├── deepmirt/
│   ├── model/              # Neural network modules
│   │   ├── mirna_target_model.py   # Full model: RNA-FM + CrossAttn + MLP
│   │   ├── rnafm_encoder.py        # RNA-FM wrapper with freeze/unfreeze
│   │   ├── cross_attention.py      # Multi-layer cross-attention block
│   │   └── classifier.py           # MLP classification head
│   ├── training/           # PyTorch Lightning training
│   │   ├── lightning_module.py     # LightningModule with metrics
│   │   ├── train.py               # Training entry point
│   │   └── callbacks.py           # Staged unfreezing callback
│   ├── data_module/        # Data loading and preprocessing
│   ├── evaluation/         # 9-step evaluation pipeline
│   ├── scanning/           # Genome-wide target site scanning
│   │   ├── scanner.py             # Core TargetScanner class
│   │   ├── site_finder.py         # Seed match finder
│   │   └── output_formatter.py    # TXT/TSV output formatters
│   ├── configs/            # YAML configuration files
│   ├── predict.py          # Public prediction & scanning API
│   └── tests/              # Unit tests
├── app.py                  # Gradio web demo
├── examples/               # Usage examples
└── docs/                   # Figures and documentation

Contributing

Contributions are welcome. Please open an issue first to discuss what you would like to change.

  1. Fork the repository
  2. Create a feature branch (git checkout -b feature/my-feature)
  3. Install dev dependencies: pip install -e ".[dev]"
  4. Run tests: pytest deepmirt/tests/
  5. Open a pull request

Citation

@software{liu2026deepmirt,
  title={DeepMiRT: miRNA Target Prediction with RNA Foundation Models},
  author={Liu, Zicheng},
  year={2026},
  url={https://github.com/zichengll/DeepMiRT}
}

License

This project is licensed under the MIT License.

Acknowledgments

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

deepmirt-1.0.0.tar.gz (159.9 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

deepmirt-1.0.0-py3-none-any.whl (187.1 kB view details)

Uploaded Python 3

File details

Details for the file deepmirt-1.0.0.tar.gz.

File metadata

  • Download URL: deepmirt-1.0.0.tar.gz
  • Upload date:
  • Size: 159.9 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/6.2.0 CPython/3.12.12

File hashes

Hashes for deepmirt-1.0.0.tar.gz
Algorithm Hash digest
SHA256 cc26fd3833579980297dd326819760c43a6470a17de67a630c1b3b1512bf4a4c
MD5 4dcf34ea52e07876348715a58d7bc1c1
BLAKE2b-256 9e768e518900476e0bab266d5bdd415db6833d87fd32da29033ce0634f7dd818

See more details on using hashes here.

File details

Details for the file deepmirt-1.0.0-py3-none-any.whl.

File metadata

  • Download URL: deepmirt-1.0.0-py3-none-any.whl
  • Upload date:
  • Size: 187.1 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/6.2.0 CPython/3.12.12

File hashes

Hashes for deepmirt-1.0.0-py3-none-any.whl
Algorithm Hash digest
SHA256 e630b9b6f141e3ac9a5e49dee4ea9d0806275a09f9f238d688dd02fc4bb76257
MD5 81aab13c0a6f464ec07fd5623eb95330
BLAKE2b-256 eebd98c9f0c6f42ccb277da1a301902bcccc6249ddd3a4cb9d5e69a549539e6b

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page