Project description
This is an application to analyze base pairing patterns of DNA/RNA 3D structures to find and classify tetrads and quadruplexes. ElTetrado assigns tetrads to one of the ONZ classes (O, N, Z) alongside with the directionality of the tetrad (+/-) determined by the bonds between bases and their non-canonical interactions. The interactions follow Leontis/Westhof classification (Leontis et al. 2001). Watson-Crick (W) edge of first base in the tetrad structure exposed to the Hoogsteen (H) edge of the next nucleobase from the same tetrad sets the tetrad directionality, clockwise (+) or anticlockwise (-). For more details, please refer to Zok et al. (2020) and Popenda et al. (2020)
Installation
This project uses uv for dependency management.
To install the package, run:
uv sync --locked
Dependencies
The project is written in Python 3.12+ and requires mmcif, orjson, NumPy and rnapolis.
Visualization is created by R 3.6+ script which uses
R4RNA (Lai et al. 2012) library. The
dependency will be automatically installed if not present.
Base pairs and stacking interactions are identified by RNApolis.
Usage
ElTetrado is a command line application, which requires to be provided
with --input and a path to a PDB or PDBx/mmCIF file.
By default, ElTetrado outputs textual results on the standard output. A
JSON version of the output can be obtained with --output switch
followed by a path where the file is supposed to be created.
ElTetrado prepares visualization of the whole structure and of each
N4-helices, quadruplexes and tetrads. This can be supplemented with
canonical base pairs visualization when --complete-2d is set. All
color settings are located in the first several lines of the quadraw.R
file, you can easily change them without knowledge of R language. If you
want ElTetrado to not visualize anything, pass --no-image switch to
it.
usage: eltetrado [-h] [-i INPUT] [-o OUTPUT]
[--g4composer-output G4COMPOSER_OUTPUT] [-m MODEL]
[--no-reorder] [--complete-2d] [--image DIR]
[-e [EXTERNAL_FILES ...]]
[--tool {fr3d,dssr,rnaview,bpnet,maxit,barnaba,mc-annotate,dnatco}]
[-v]
options:
-h, --help show this help message and exit
-i, --input INPUT path to input PDB or PDBx/mmCIF file
-o, --output OUTPUT (optional) path for output JSON file
--g4composer-output G4COMPOSER_OUTPUT
(optional) path for g4composer plain-text export;
requires exactly one unimolecular quadruplex and
exports the full involved chain
-m, --model MODEL (optional) model number to process
--no-reorder chains of bi- and tetramolecular quadruplexes should
be reordered to be able to have them classified; when
this is set, chains will be processed in original
order, which for bi-/tetramolecular means that they
will likely be misclassified; use with care!
--complete-2d when set, the visualization will also show canonical
base pairs to provide context for the quadruplex
--image DIR directory where visualization files (PDF) will be
saved; if omitted, no images are generated
-e, --external-files [EXTERNAL_FILES ...]
path(s) to external tool output file(s); if omitted
ElTetrado will compute interactions itself
--tool {fr3d,dssr,rnaview,bpnet,maxit,barnaba,mc-annotate,dnatco}
name of the external tool that produced the files
(auto-detected when not provided)
-v, --version show program's version number and exit
Chains reorder
ElTetrado keeps a global and unique 5’-3’ index for every nucleotide which is independent from residue numbers. For example, if a structure has chain M with 60 nucleotides and chain N with 15 nucleotides, then ElTetrado will keep index between 0 and 74 which uniquely identifies every nucleotide. Initially, ElTetrado assigns this indices according to the order of chains in the input file. Therefore, if M preceded N then nucleotides in M will be indexed from 0 to 59 and in N from 60 to 74. Otherwise, nucleotides in N will be indexed from 0 to 14 and in M from 15 to 74.
When --no-reorder is present, this initial assignment is used.
Otherwise, ElTetrado exhaustively checks all permutations of chains’
orders. Every permutation check induces recalculation of the global and
unique 5’-3’ index and in effect it changes ONZ classification of
tetrads.
ElTetrado keeps a table of tetrad classification scores according to these rules:
- Type preference:
O>N>Z - Direction preference:
+>-
The table keeps low values for preferred classes i.e. O+ is 0, O- is
1 and so on up to Z- with score 5. For every permutation of chain
orders, ElTetrado computes sum of scores for tetrads classification
induced by 5’-3’ indexing. We select permutation with the minimum value.
g4composer export
The g4composer exporter uses the same structural analysis as the main ElTetrado output, but it applies g4composer-specific conventions at export time:
- Only a single unimolecular quadruplex with at least two tetrads is supported.
- The exported residue span covers the whole chain containing the quadruplex, including 5’ and 3’ flanking single strands.
- Tetrad letters (
A,B,C, …) still follow tetrad 5’ order. - Path columns are numbered so that
1is always the tract containing the 5’-most nucleotide of tetradA. Core ElTetrado path columns are numbered anticlockwise after that anchor, but g4composer path columns are numbered clockwise. This affects only the exported g4composerpath, not ElTetrado’s internal topology model or JSONpath. orientis exported from ElTetrado tetrad polarities:clockwise -> +,anticlockwise -> -.riseandtwistare exported between consecutive build-order tetrads. Both are measured against a single, quadruplex-wide reference axis so that signs are comparable across the whole build order, even when it reverses ElTetrado’s internal (discovery-order) stack of adjacent tetrad pairs. The axis is built by chain-aligning each tetrad’s plane normal to its discovery-order neighbour, averaging the aligned normals, and orienting the result along the net displacement from the first to the last tetrad in discovery order.riseis the projection of the centroid-to-centroid displacement onto that shared axis.twistis the best-fit signed rotation of the four tract-matchedC1'atoms around the same axis. MissingC1'atoms yield an undefined twist.
Example g4composer export:
name 6tc8
sequence gggatgggacacaggggacggg
structure ^^...^^^.....^^^^..^^^
chi S....S.......S.....S..
sugar SSSSSSSSSSSSSSSSSSSSSS
orient A+;B-;C+
rise 3.4;-6.8
twist 19;-46
path A1;B1;B4;A4;C4;C1;B2;A2;C2;B3;A3;C3
Examples
2HY9: Human telomere DNA quadruplex structure in K+ solution hybrid-1 form
$ curl ftp://ftp.wwpdb.org/pub/pdb/data/structures/divided/mmCIF/my/2hy9.cif.gz | gzip -d > 2hy9.cif
$ uv run --locked eltetrado --input 2hy9.cif --output 2hy9.json
Chain order: 1
n4-helix with 3 tetrads
Oh* V 9a -(pll) quadruplex with 3 tetrads
Handedness: right
Tetrad polarities: clockwise, anticlockwise, anticlockwise
1.DG4 1.DG22 1.DG18 1.DG10 cWH cWH cWH cWH O- Vb planarity=0.06
direction=hybrid rise=3.15 twist=18.78
1.DG5 1.DG23 1.DG17 1.DG11 cHW cHW cHW cHW O+ Va planarity=0.05
direction=hybrid rise=3.08 twist=27.86
1.DG6 1.DG24 1.DG16 1.DG12 cHW cHW cHW cHW O+ Va planarity=0.05
Tracts:
1.DG4, 1.DG5, 1.DG6
1.DG10, 1.DG11, 1.DG12
1.DG18, 1.DG17, 1.DG16
1.DG22, 1.DG23, 1.DG24
Path:
A1, B1, C1, A2, B2, C2, C3, B3, A3, A4, B4, C4
Loops:
propeller- 1.DT7, 1.DT8, 1.DA9
lateral- 1.DT13, 1.DT14, 1.DA15
lateral- 1.DT19, 1.DT20, 1.DA21
AAAGGGTTAGGGTTAGGGTTAGGGAA
...(([...{)]...[[}...)]]..
...([{...)((...))(...)]}..
Click to see the output JSON
{
"metals": [],
"nucleotides": [
{
"index": 1,
"chain": "1",
"number": 1,
"icode": null,
"molecule": "DNA",
"fullName": "1.DA1",
"shortName": "A",
"chi": 22.30828283085781,
"glycosidicBond": "syn",
"sugarPucker": "North"
},
{
"index": 2,
"chain": "1",
"number": 2,
"icode": null,
"molecule": "DNA",
"fullName": "1.DA2",
"shortName": "A",
"chi": -123.05454402191421,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 3,
"chain": "1",
"number": 3,
"icode": null,
"molecule": "DNA",
"fullName": "1.DA3",
"shortName": "A",
"chi": -94.96579955603106,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 4,
"chain": "1",
"number": 4,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG4",
"shortName": "G",
"chi": 79.28363721639316,
"glycosidicBond": "syn",
"sugarPucker": "North"
},
{
"index": 5,
"chain": "1",
"number": 5,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG5",
"shortName": "G",
"chi": -126.01709201555563,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 6,
"chain": "1",
"number": 6,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG6",
"shortName": "G",
"chi": -127.26656202302102,
"glycosidicBond": "anti",
"sugarPucker": "South"
},
{
"index": 7,
"chain": "1",
"number": 7,
"icode": null,
"molecule": "DNA",
"fullName": "1.DT7",
"shortName": "T",
"chi": -63.10830751967371,
"glycosidicBond": "anti",
"sugarPucker": "South"
},
{
"index": 8,
"chain": "1",
"number": 8,
"icode": null,
"molecule": "DNA",
"fullName": "1.DT8",
"shortName": "T",
"chi": -138.79520345559828,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 9,
"chain": "1",
"number": 9,
"icode": null,
"molecule": "DNA",
"fullName": "1.DA9",
"shortName": "A",
"chi": -148.83990757408878,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 10,
"chain": "1",
"number": 10,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG10",
"shortName": "G",
"chi": 58.77875250191579,
"glycosidicBond": "syn",
"sugarPucker": "North"
},
{
"index": 11,
"chain": "1",
"number": 11,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG11",
"shortName": "G",
"chi": -123.85746807924986,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 12,
"chain": "1",
"number": 12,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG12",
"shortName": "G",
"chi": -84.36679807284759,
"glycosidicBond": "anti",
"sugarPucker": "South"
},
{
"index": 13,
"chain": "1",
"number": 13,
"icode": null,
"molecule": "DNA",
"fullName": "1.DT13",
"shortName": "T",
"chi": -30.819029132834157,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 14,
"chain": "1",
"number": 14,
"icode": null,
"molecule": "DNA",
"fullName": "1.DT14",
"shortName": "T",
"chi": -168.51776782812965,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 15,
"chain": "1",
"number": 15,
"icode": null,
"molecule": "DNA",
"fullName": "1.DA15",
"shortName": "A",
"chi": -105.72881577106517,
"glycosidicBond": "anti",
"sugarPucker": "South"
},
{
"index": 16,
"chain": "1",
"number": 16,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG16",
"shortName": "G",
"chi": 74.3227942181243,
"glycosidicBond": "syn",
"sugarPucker": "South"
},
{
"index": 17,
"chain": "1",
"number": 17,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG17",
"shortName": "G",
"chi": 81.08424926936044,
"glycosidicBond": "syn",
"sugarPucker": "South"
},
{
"index": 18,
"chain": "1",
"number": 18,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG18",
"shortName": "G",
"chi": -122.90397217111551,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 19,
"chain": "1",
"number": 19,
"icode": null,
"molecule": "DNA",
"fullName": "1.DT19",
"shortName": "T",
"chi": -102.98239337113938,
"glycosidicBond": "anti",
"sugarPucker": "South"
},
{
"index": 20,
"chain": "1",
"number": 20,
"icode": null,
"molecule": "DNA",
"fullName": "1.DT20",
"shortName": "T",
"chi": -112.15146018497148,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 21,
"chain": "1",
"number": 21,
"icode": null,
"molecule": "DNA",
"fullName": "1.DA21",
"shortName": "A",
"chi": -89.07113063649612,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 22,
"chain": "1",
"number": 22,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG22",
"shortName": "G",
"chi": 83.44318693001902,
"glycosidicBond": "syn",
"sugarPucker": "South"
},
{
"index": 23,
"chain": "1",
"number": 23,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG23",
"shortName": "G",
"chi": -115.41210237198395,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 24,
"chain": "1",
"number": 24,
"icode": null,
"molecule": "DNA",
"fullName": "1.DG24",
"shortName": "G",
"chi": -111.14845782593532,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 25,
"chain": "1",
"number": 25,
"icode": null,
"molecule": "DNA",
"fullName": "1.DA25",
"shortName": "A",
"chi": -58.323530637551954,
"glycosidicBond": "anti",
"sugarPucker": "South"
},
{
"index": 26,
"chain": "1",
"number": 26,
"icode": null,
"molecule": "DNA",
"fullName": "1.DA26",
"shortName": "A",
"chi": -90.84065243137135,
"glycosidicBond": "anti",
"sugarPucker": "North"
}
],
"basePairs": [
{
"nt1": "1.DA3",
"nt2": "1.DA21",
"lw": "cHW",
"inTetrad": false,
"canonical": false
},
{
"nt1": "1.DG4",
"nt2": "1.DG10",
"lw": "cHW",
"inTetrad": true,
"canonical": false
},
{
"nt1": "1.DG4",
"nt2": "1.DG22",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "1.DG5",
"nt2": "1.DG11",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "1.DG5",
"nt2": "1.DG23",
"lw": "cHW",
"inTetrad": true,
"canonical": false
},
{
"nt1": "1.DG6",
"nt2": "1.DG12",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "1.DG6",
"nt2": "1.DG24",
"lw": "cHW",
"inTetrad": true,
"canonical": false
},
{
"nt1": "1.DG10",
"nt2": "1.DG18",
"lw": "cHW",
"inTetrad": true,
"canonical": false
},
{
"nt1": "1.DG11",
"nt2": "1.DG17",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "1.DG12",
"nt2": "1.DG16",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "1.DT14",
"nt2": "1.DA25",
"lw": "tWW",
"inTetrad": false,
"canonical": false
},
{
"nt1": "1.DG16",
"nt2": "1.DG24",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "1.DG17",
"nt2": "1.DG23",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "1.DG18",
"nt2": "1.DG22",
"lw": "cHW",
"inTetrad": true,
"canonical": false
}
],
"helices": [
{
"quadruplexes": [
{
"tetrads": [
{
"id": "1.DG4-1.DG22-1.DG18-1.DG10",
"nt1": "1.DG4",
"nt2": "1.DG22",
"nt3": "1.DG18",
"nt4": "1.DG10",
"onz": "O-",
"gbaClassification": "Vb",
"planarityDeviation": 0.06027201827666498,
"ionsChannel": [],
"ionsOutside": []
},
{
"id": "1.DG5-1.DG23-1.DG17-1.DG11",
"nt1": "1.DG5",
"nt2": "1.DG23",
"nt3": "1.DG17",
"nt4": "1.DG11",
"onz": "O+",
"gbaClassification": "Va",
"planarityDeviation": 0.05012803856522407,
"ionsChannel": [],
"ionsOutside": []
},
{
"id": "1.DG6-1.DG24-1.DG16-1.DG12",
"nt1": "1.DG6",
"nt2": "1.DG24",
"nt3": "1.DG16",
"nt4": "1.DG12",
"onz": "O+",
"gbaClassification": "Va",
"planarityDeviation": 0.05469205291187412,
"ionsChannel": [],
"ionsOutside": []
}
],
"onzm": "Oh*",
"handedness": "right",
"tetradPolarities": ["clockwise", "anticlockwise", "anticlockwise"],
"strandPolarities": [
["plus", "plus", "plus"],
["plus", "plus", "plus"],
["minus", "minus", "minus"],
["plus", "plus", "plus"]
],
"loopClassification": {
"classification": "9a",
"loopProgression": "-(pll)"
},
"gbaClassification": ["V"],
"tracts": [
["1.DG4", "1.DG5", "1.DG6"],
["1.DG10", "1.DG11", "1.DG12"],
["1.DG18", "1.DG17", "1.DG16"],
["1.DG22", "1.DG23", "1.DG24"]
],
"path": ["A1", "B1", "C1", "A2", "B2", "C2", "C3", "B3", "A3", "A4", "B4", "C4"],
"bulges": [],
"loops": [
{
"type": "propeller-",
"nucleotides": ["1.DT7", "1.DT8", "1.DA9"]
},
{
"type": "lateral-",
"nucleotides": ["1.DT13", "1.DT14", "1.DA15"]
},
{
"type": "lateral-",
"nucleotides": ["1.DT19", "1.DT20", "1.DA21"]
}
]
}
],
"tetradPairs": [
{
"tetrad1": "1.DG4-1.DG22-1.DG18-1.DG10",
"tetrad2": "1.DG5-1.DG23-1.DG17-1.DG11",
"direction": "hybrid",
"rise": 3.150278534585139,
"twist": 18.779470679029647
},
{
"tetrad1": "1.DG5-1.DG23-1.DG17-1.DG11",
"tetrad2": "1.DG6-1.DG24-1.DG16-1.DG12",
"direction": "hybrid",
"rise": 3.0769001101988023,
"twist": 27.8635274108319
}
]
}
],
"dotBracket": {
"sequence": "AAAGGGTTAGGGTTAGGGTTAGGGAA",
"line1": "...(([...{)]...[[}...)]]..",
"line2": "...([{...)((...))(...)]}.."
},
"quadruplexDotBracket": {
"sequence": "AAAGGGTTAGGGTTAGGGTTAGGGAA",
"structure": "...qRS...Qrs...SRq...Qrs..",
"chi": "saasaaaaasaaaaassaaaasaaaa",
"sugar": "NNNNNSSNNNNSNNSSSNSNNSNNSN",
"loop": "......ppp...lll...lll....."
}
}
4RJ1: Structural variations and solvent structure of UGGGGU quadruplexes stabilized by Sr2+ ions
$ curl https://www.ebi.ac.uk/pdbe/static/entry/download/4rj1-assembly-1.cif.gz | gzip -d > 4rj1-1.cif
$ uv run --locked eltetrado --input 4rj1-1.cif --output 4rj1-1.json
Chain order: A AB AA AC B BC BA BB
n4-helix with 10 tetrads
Op* VIII n/a quadruplex with 5 tetrads
Handedness: right
Tetrad polarities: anticlockwise, clockwise, clockwise, clockwise, clockwise
A.U1006 AC.U1006 AA.U1006 AB.U1006 cWH cWH cWH cWH O- VIIIa planarity=0.34 ions_outside=A.U1006: [SR] AA.U1006: [SR] AB.U1006: [SR] AC.U1006: [SR]
direction=parallel rise=3.35 twist=-39.96
A.G1005 AC.G1005 AA.G1005 AB.G1005 cHW cHW cHW cHW O+ VIIIa planarity=0.23
direction=parallel rise=3.41 twist=25.9
A.G1004 AC.G1004 AA.G1004 AB.G1004 cHW cHW cHW cHW O+ VIIIa planarity=0.11 ions_channel=SR
direction=parallel rise=3.31 twist=35.81
A.G1003 AC.G1003 AA.G1003 AB.G1003 cHW cHW cHW cHW O+ VIIIa planarity=0.15 ions_channel=SR
direction=parallel rise=3.33 twist=27.12
A.G1002 AC.G1002 AA.G1002 AB.G1002 cHW cHW cHW cHW O+ VIIIa planarity=0.16 ions_outside=AB.G1002: [CA] AC.G1002: [CA] AA.G1002: [CA] A.G1002: [CA]
Tracts:
A.U1006, A.G1005, A.G1004, A.G1003, A.G1002
AC.U1006, AC.G1005, AC.G1004, AC.G1003, AC.G1002
AA.U1006, AA.G1005, AA.G1004, AA.G1003, AA.G1002
AB.U1006, AB.G1005, AB.G1004, AB.G1003, AB.G1002
Path:
A1, B1, C1, D1, E1, A4, B4, C4, D4, E4, A3, B3, C3, D3, E3, A2, B2, C2, D2, E2
Op* VIII n/a quadruplex with 5 tetrads
Handedness: right
Tetrad polarities: anticlockwise, anticlockwise, anticlockwise, anticlockwise, clockwise
B.G2002 BC.G2002 BA.G2002 BB.G2002 cWH cWH cWH cWH O+ VIIIa planarity=0.19
direction=parallel rise=3.4 twist=27.41
B.G2003 BC.G2003 BA.G2003 BB.G2003 cWH cWH cWH cWH O+ VIIIa planarity=0.16 ions_channel=SR ions_outside=B.G2003: [CA] BA.G2003: [CA] BB.G2003: [CA] BC.G2003: [CA]
direction=parallel rise=3.29 twist=35.04
B.G2004 BC.G2004 BA.G2004 BB.G2004 cWH cWH cWH cWH O+ VIIIa planarity=0.06 ions_channel=SR
direction=parallel rise=3.35 twist=25.15
B.G2005 BC.G2005 BA.G2005 BB.G2005 cWH cWH cWH cWH O+ VIIIa planarity=0.22
direction=parallel rise=6.89 twist=-43.41
B.U2006 BC.U2006 BA.U2006 BB.U2006 cHW cHW cHW cHW O- VIIIa planarity=0.5 ions_channel=NA,NA
Tracts:
B.G2002, B.G2003, B.G2004, B.G2005, B.U2006
BC.G2002, BC.G2003, BC.G2004, BC.G2005, BC.U2006
BA.G2002, BA.G2003, BA.G2004, BA.G2005, BA.U2006
BB.G2002, BB.G2003, BB.G2004, BB.G2005, BB.U2006
Path:
A1, B1, C1, D1, E1, A2, B2, C2, D2, E2, A3, B3, C3, D3, E3, A4, B4, C4, D4, E4
UGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGGU
.([{<-A.)]}>-(.[{<A-).]}>a-a.([{<-A.)]}>-(.[{<A-).]}>aa
.([{<-(.[{<A-).]}>a-A.)]}>-a.([{<-(.[{<A-).]}>a-A.)]}>a
Click to see the output JSON
{
"metals": [
{
"symbol": "Sr",
"count": 8
},
{
"symbol": "Na",
"count": 2
},
{
"symbol": "Ca",
"count": 8
}
],
"nucleotides": [
{
"index": 1,
"chain": "A",
"number": 1001,
"icode": null,
"molecule": "RNA",
"fullName": "A.U1001",
"shortName": "U",
"chi": -141.92671313255752,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 2,
"chain": "A",
"number": 1002,
"icode": null,
"molecule": "RNA",
"fullName": "A.G1002",
"shortName": "G",
"chi": -165.93034671112116,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 3,
"chain": "A",
"number": 1003,
"icode": null,
"molecule": "RNA",
"fullName": "A.G1003",
"shortName": "G",
"chi": -121.5652426033226,
"glycosidicBond": "anti",
"sugarPucker": "South"
},
{
"index": 4,
"chain": "A",
"number": 1004,
"icode": null,
"molecule": "RNA",
"fullName": "A.G1004",
"shortName": "G",
"chi": -156.00957673923344,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 5,
"chain": "A",
"number": 1005,
"icode": null,
"molecule": "RNA",
"fullName": "A.G1005",
"shortName": "G",
"chi": -148.10051684016415,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 6,
"chain": "A",
"number": 1006,
"icode": null,
"molecule": "RNA",
"fullName": "A.U1006",
"shortName": "U",
"chi": -137.28005568139983,
"glycosidicBond": "anti",
"sugarPucker": "South"
},
{
"index": 13,
"chain": "AA",
"number": 1001,
"icode": null,
"molecule": "RNA",
"fullName": "AA.U1001",
"shortName": "U",
"chi": -141.9267131325575,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 14,
"chain": "AA",
"number": 1002,
"icode": null,
"molecule": "RNA",
"fullName": "AA.G1002",
"shortName": "G",
"chi": -165.93034671112113,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 15,
"chain": "AA",
"number": 1003,
"icode": null,
"molecule": "RNA",
"fullName": "AA.G1003",
"shortName": "G",
"chi": -121.56524260332266,
"glycosidicBond": "anti",
"sugarPucker": "South"
},
{
"index": 16,
"chain": "AA",
"number": 1004,
"icode": null,
"molecule": "RNA",
"fullName": "AA.G1004",
"shortName": "G",
"chi": -156.0095767392335,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 17,
"chain": "AA",
"number": 1005,
"icode": null,
"molecule": "RNA",
"fullName": "AA.G1005",
"shortName": "G",
"chi": -148.10051684016406,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 18,
"chain": "AA",
"number": 1006,
"icode": null,
"molecule": "RNA",
"fullName": "AA.U1006",
"shortName": "U",
"chi": -137.2800556813998,
"glycosidicBond": "anti",
"sugarPucker": "South"
},
{
"index": 7,
"chain": "AB",
"number": 1001,
"icode": null,
"molecule": "RNA",
"fullName": "AB.U1001",
"shortName": "U",
"chi": -141.92671313255744,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 8,
"chain": "AB",
"number": 1002,
"icode": null,
"molecule": "RNA",
"fullName": "AB.G1002",
"shortName": "G",
"chi": -165.93034671112113,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 9,
"chain": "AB",
"number": 1003,
"icode": null,
"molecule": "RNA",
"fullName": "AB.G1003",
"shortName": "G",
"chi": -121.56524260332263,
"glycosidicBond": "anti",
"sugarPucker": "South"
},
{
"index": 10,
"chain": "AB",
"number": 1004,
"icode": null,
"molecule": "RNA",
"fullName": "AB.G1004",
"shortName": "G",
"chi": -156.00957673923347,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 11,
"chain": "AB",
"number": 1005,
"icode": null,
"molecule": "RNA",
"fullName": "AB.G1005",
"shortName": "G",
"chi": -148.10051684016406,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 12,
"chain": "AB",
"number": 1006,
"icode": null,
"molecule": "RNA",
"fullName": "AB.U1006",
"shortName": "U",
"chi": -137.28005568139977,
"glycosidicBond": "anti",
"sugarPucker": "South"
},
{
"index": 19,
"chain": "AC",
"number": 1001,
"icode": null,
"molecule": "RNA",
"fullName": "AC.U1001",
"shortName": "U",
"chi": -141.92671313255747,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 20,
"chain": "AC",
"number": 1002,
"icode": null,
"molecule": "RNA",
"fullName": "AC.G1002",
"shortName": "G",
"chi": -165.93034671112116,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 21,
"chain": "AC",
"number": 1003,
"icode": null,
"molecule": "RNA",
"fullName": "AC.G1003",
"shortName": "G",
"chi": -121.56524260332263,
"glycosidicBond": "anti",
"sugarPucker": "South"
},
{
"index": 22,
"chain": "AC",
"number": 1004,
"icode": null,
"molecule": "RNA",
"fullName": "AC.G1004",
"shortName": "G",
"chi": -156.00957673923352,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 23,
"chain": "AC",
"number": 1005,
"icode": null,
"molecule": "RNA",
"fullName": "AC.G1005",
"shortName": "G",
"chi": -148.1005168401641,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 24,
"chain": "AC",
"number": 1006,
"icode": null,
"molecule": "RNA",
"fullName": "AC.U1006",
"shortName": "U",
"chi": -137.28005568139986,
"glycosidicBond": "anti",
"sugarPucker": "South"
},
{
"index": 25,
"chain": "B",
"number": 2001,
"icode": null,
"molecule": "RNA",
"fullName": "B.U2001",
"shortName": "U",
"chi": -146.4615316869476,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 26,
"chain": "B",
"number": 2002,
"icode": null,
"molecule": "RNA",
"fullName": "B.G2002",
"shortName": "G",
"chi": -170.79660912745996,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 27,
"chain": "B",
"number": 2003,
"icode": null,
"molecule": "RNA",
"fullName": "B.G2003",
"shortName": "G",
"chi": -117.68718110874113,
"glycosidicBond": "anti",
"sugarPucker": "South"
},
{
"index": 28,
"chain": "B",
"number": 2004,
"icode": null,
"molecule": "RNA",
"fullName": "B.G2004",
"shortName": "G",
"chi": -153.88587375071324,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 29,
"chain": "B",
"number": 2005,
"icode": null,
"molecule": "RNA",
"fullName": "B.G2005",
"shortName": "G",
"chi": -148.85199128456694,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 30,
"chain": "B",
"number": 2006,
"icode": null,
"molecule": "RNA",
"fullName": "B.U2006",
"shortName": "U",
"chi": -159.43730655241544,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 37,
"chain": "BA",
"number": 2001,
"icode": null,
"molecule": "RNA",
"fullName": "BA.U2001",
"shortName": "U",
"chi": -146.46153168694764,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 38,
"chain": "BA",
"number": 2002,
"icode": null,
"molecule": "RNA",
"fullName": "BA.G2002",
"shortName": "G",
"chi": -170.7966091274599,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 39,
"chain": "BA",
"number": 2003,
"icode": null,
"molecule": "RNA",
"fullName": "BA.G2003",
"shortName": "G",
"chi": -117.68718110874113,
"glycosidicBond": "anti",
"sugarPucker": "South"
},
{
"index": 40,
"chain": "BA",
"number": 2004,
"icode": null,
"molecule": "RNA",
"fullName": "BA.G2004",
"shortName": "G",
"chi": -153.88587375071322,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 41,
"chain": "BA",
"number": 2005,
"icode": null,
"molecule": "RNA",
"fullName": "BA.G2005",
"shortName": "G",
"chi": -148.851991284567,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 42,
"chain": "BA",
"number": 2006,
"icode": null,
"molecule": "RNA",
"fullName": "BA.U2006",
"shortName": "U",
"chi": -159.43730655241544,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 43,
"chain": "BB",
"number": 2001,
"icode": null,
"molecule": "RNA",
"fullName": "BB.U2001",
"shortName": "U",
"chi": -146.4615316869476,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 44,
"chain": "BB",
"number": 2002,
"icode": null,
"molecule": "RNA",
"fullName": "BB.G2002",
"shortName": "G",
"chi": -170.79660912745993,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 45,
"chain": "BB",
"number": 2003,
"icode": null,
"molecule": "RNA",
"fullName": "BB.G2003",
"shortName": "G",
"chi": -117.68718110874106,
"glycosidicBond": "anti",
"sugarPucker": "South"
},
{
"index": 46,
"chain": "BB",
"number": 2004,
"icode": null,
"molecule": "RNA",
"fullName": "BB.G2004",
"shortName": "G",
"chi": -153.8858737507132,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 47,
"chain": "BB",
"number": 2005,
"icode": null,
"molecule": "RNA",
"fullName": "BB.G2005",
"shortName": "G",
"chi": -148.85199128456696,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 48,
"chain": "BB",
"number": 2006,
"icode": null,
"molecule": "RNA",
"fullName": "BB.U2006",
"shortName": "U",
"chi": -159.43730655241544,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 31,
"chain": "BC",
"number": 2001,
"icode": null,
"molecule": "RNA",
"fullName": "BC.U2001",
"shortName": "U",
"chi": -146.4615316869476,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 32,
"chain": "BC",
"number": 2002,
"icode": null,
"molecule": "RNA",
"fullName": "BC.G2002",
"shortName": "G",
"chi": -170.79660912745993,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 33,
"chain": "BC",
"number": 2003,
"icode": null,
"molecule": "RNA",
"fullName": "BC.G2003",
"shortName": "G",
"chi": -117.68718110874121,
"glycosidicBond": "anti",
"sugarPucker": "South"
},
{
"index": 34,
"chain": "BC",
"number": 2004,
"icode": null,
"molecule": "RNA",
"fullName": "BC.G2004",
"shortName": "G",
"chi": -153.88587375071322,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 35,
"chain": "BC",
"number": 2005,
"icode": null,
"molecule": "RNA",
"fullName": "BC.G2005",
"shortName": "G",
"chi": -148.85199128456694,
"glycosidicBond": "anti",
"sugarPucker": "North"
},
{
"index": 36,
"chain": "BC",
"number": 2006,
"icode": null,
"molecule": "RNA",
"fullName": "BC.U2006",
"shortName": "U",
"chi": -159.43730655241544,
"glycosidicBond": "anti",
"sugarPucker": "North"
}
],
"basePairs": [
{
"nt1": "A.G1002",
"nt2": "AB.G1002",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "A.G1002",
"nt2": "AC.G1002",
"lw": "cHW",
"inTetrad": true,
"canonical": false
},
{
"nt1": "A.G1003",
"nt2": "AB.G1003",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "A.G1003",
"nt2": "AC.G1003",
"lw": "cHW",
"inTetrad": true,
"canonical": false
},
{
"nt1": "A.G1003",
"nt2": "AC.G1004",
"lw": "cSS",
"inTetrad": false,
"canonical": false
},
{
"nt1": "A.G1004",
"nt2": "AB.G1003",
"lw": "cSS",
"inTetrad": false,
"canonical": false
},
{
"nt1": "A.G1004",
"nt2": "AB.G1004",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "A.G1004",
"nt2": "AC.G1004",
"lw": "cHW",
"inTetrad": true,
"canonical": false
},
{
"nt1": "A.G1005",
"nt2": "AB.G1005",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "A.G1005",
"nt2": "AC.G1005",
"lw": "cHW",
"inTetrad": true,
"canonical": false
},
{
"nt1": "A.U1006",
"nt2": "AB.U1006",
"lw": "cHW",
"inTetrad": true,
"canonical": false
},
{
"nt1": "A.U1006",
"nt2": "AC.U1006",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "AB.G1002",
"nt2": "AA.G1002",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "AA.G1002",
"nt2": "AC.G1002",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "AB.G1003",
"nt2": "AA.G1003",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "AB.G1004",
"nt2": "AA.G1003",
"lw": "cSS",
"inTetrad": false,
"canonical": false
},
{
"nt1": "AA.G1003",
"nt2": "AC.G1003",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "AB.G1004",
"nt2": "AA.G1004",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "AA.G1004",
"nt2": "AC.G1003",
"lw": "cSS",
"inTetrad": false,
"canonical": false
},
{
"nt1": "AA.G1004",
"nt2": "AC.G1004",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "AB.G1005",
"nt2": "AA.G1005",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "AA.G1005",
"nt2": "AC.G1005",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "AB.U1006",
"nt2": "AA.U1006",
"lw": "cHW",
"inTetrad": true,
"canonical": false
},
{
"nt1": "AA.U1006",
"nt2": "AC.U1006",
"lw": "cHW",
"inTetrad": true,
"canonical": false
},
{
"nt1": "B.G2002",
"nt2": "BB.G2002",
"lw": "cHW",
"inTetrad": true,
"canonical": false
},
{
"nt1": "B.G2002",
"nt2": "BC.G2002",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "B.G2003",
"nt2": "BB.G2003",
"lw": "cHW",
"inTetrad": true,
"canonical": false
},
{
"nt1": "B.G2003",
"nt2": "BC.G2003",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "B.G2004",
"nt2": "BB.G2004",
"lw": "cHW",
"inTetrad": true,
"canonical": false
},
{
"nt1": "B.G2004",
"nt2": "BC.G2004",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "B.G2005",
"nt2": "BB.G2005",
"lw": "cHW",
"inTetrad": true,
"canonical": false
},
{
"nt1": "B.G2005",
"nt2": "BC.G2005",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "B.U2006",
"nt2": "BB.U2006",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "B.U2006",
"nt2": "BC.U2006",
"lw": "cHW",
"inTetrad": true,
"canonical": false
},
{
"nt1": "BA.G2002",
"nt2": "BB.G2002",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "BC.G2002",
"nt2": "BA.G2002",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "BA.G2003",
"nt2": "BB.G2003",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "BC.G2003",
"nt2": "BA.G2003",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "BC.G2004",
"nt2": "BA.G2003",
"lw": "cSS",
"inTetrad": false,
"canonical": false
},
{
"nt1": "BA.G2004",
"nt2": "BB.G2004",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "BC.G2004",
"nt2": "BA.G2004",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "BA.G2005",
"nt2": "BB.G2005",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "BC.G2005",
"nt2": "BA.G2005",
"lw": "cWH",
"inTetrad": true,
"canonical": false
},
{
"nt1": "BA.U2006",
"nt2": "BB.U2006",
"lw": "cHW",
"inTetrad": true,
"canonical": false
},
{
"nt1": "BC.U2006",
"nt2": "BA.U2006",
"lw": "cHW",
"inTetrad": true,
"canonical": false
}
],
"helices": [
{
"quadruplexes": [
{
"tetrads": [
{
"id": "A.U1006-AC.U1006-AA.U1006-AB.U1006",
"nt1": "A.U1006",
"nt2": "AC.U1006",
"nt3": "AA.U1006",
"nt4": "AB.U1006",
"onz": "O-",
"gbaClassification": "VIIIa",
"planarityDeviation": 0.34191400600150934,
"ionsChannel": [],
"ionsOutside": [
{
"nt": "A.U1006",
"ion": "Sr"
},
{
"nt": "AA.U1006",
"ion": "Sr"
},
{
"nt": "AB.U1006",
"ion": "Sr"
},
{
"nt": "AC.U1006",
"ion": "Sr"
}
]
},
{
"id": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
"nt1": "A.G1005",
"nt2": "AC.G1005",
"nt3": "AA.G1005",
"nt4": "AB.G1005",
"onz": "O+",
"gbaClassification": "VIIIa",
"planarityDeviation": 0.22931709613221674,
"ionsChannel": [],
"ionsOutside": []
},
{
"id": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
"nt1": "A.G1004",
"nt2": "AC.G1004",
"nt3": "AA.G1004",
"nt4": "AB.G1004",
"onz": "O+",
"gbaClassification": "VIIIa",
"planarityDeviation": 0.11204500276508543,
"ionsChannel": ["Sr"],
"ionsOutside": []
},
{
"id": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
"nt1": "A.G1003",
"nt2": "AC.G1003",
"nt3": "AA.G1003",
"nt4": "AB.G1003",
"onz": "O+",
"gbaClassification": "VIIIa",
"planarityDeviation": 0.14900890205810532,
"ionsChannel": ["Sr"],
"ionsOutside": []
},
{
"id": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
"nt1": "A.G1002",
"nt2": "AC.G1002",
"nt3": "AA.G1002",
"nt4": "AB.G1002",
"onz": "O+",
"gbaClassification": "VIIIa",
"planarityDeviation": 0.157182265102682,
"ionsChannel": [],
"ionsOutside": [
{
"nt": "AB.G1002",
"ion": "Ca"
},
{
"nt": "AC.G1002",
"ion": "Ca"
},
{
"nt": "AA.G1002",
"ion": "Ca"
},
{
"nt": "A.G1002",
"ion": "Ca"
}
]
}
],
"onzm": "Op*",
"handedness": "right",
"tetradPolarities": ["anticlockwise", "clockwise", "clockwise", "clockwise", "clockwise"],
"strandPolarities": [
["minus", "plus", "plus", "plus", "plus"],
["minus", "plus", "plus", "plus", "plus"],
["minus", "plus", "plus", "plus", "plus"],
["minus", "plus", "plus", "plus", "plus"]
],
"loopClassification": null,
"gbaClassification": ["VIII"],
"tracts": [
["A.U1006", "A.G1005", "A.G1004", "A.G1003", "A.G1002"],
["AC.U1006", "AC.G1005", "AC.G1004", "AC.G1003", "AC.G1002"],
["AA.U1006", "AA.G1005", "AA.G1004", "AA.G1003", "AA.G1002"],
["AB.U1006", "AB.G1005", "AB.G1004", "AB.G1003", "AB.G1002"]
],
"path": ["A1", "B1", "C1", "D1", "E1", "A4", "B4", "C4", "D4", "E4", "A3", "B3", "C3", "D3", "E3", "A2", "B2", "C2", "D2", "E2"],
"bulges": [],
"loops": []
},
{
"tetrads": [
{
"id": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
"nt1": "B.G2002",
"nt2": "BC.G2002",
"nt3": "BA.G2002",
"nt4": "BB.G2002",
"onz": "O+",
"gbaClassification": "VIIIa",
"planarityDeviation": 0.1941232461884563,
"ionsChannel": [],
"ionsOutside": []
},
{
"id": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
"nt1": "B.G2003",
"nt2": "BC.G2003",
"nt3": "BA.G2003",
"nt4": "BB.G2003",
"onz": "O+",
"gbaClassification": "VIIIa",
"planarityDeviation": 0.15566413303664228,
"ionsChannel": ["Sr"],
"ionsOutside": [
{
"nt": "B.G2003",
"ion": "Ca"
},
{
"nt": "BA.G2003",
"ion": "Ca"
},
{
"nt": "BB.G2003",
"ion": "Ca"
},
{
"nt": "BC.G2003",
"ion": "Ca"
}
]
},
{
"id": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
"nt1": "B.G2004",
"nt2": "BC.G2004",
"nt3": "BA.G2004",
"nt4": "BB.G2004",
"onz": "O+",
"gbaClassification": "VIIIa",
"planarityDeviation": 0.06292564154330361,
"ionsChannel": ["Sr"],
"ionsOutside": []
},
{
"id": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
"nt1": "B.G2005",
"nt2": "BC.G2005",
"nt3": "BA.G2005",
"nt4": "BB.G2005",
"onz": "O+",
"gbaClassification": "VIIIa",
"planarityDeviation": 0.22228215261667064,
"ionsChannel": [],
"ionsOutside": []
},
{
"id": "B.U2006-BC.U2006-BA.U2006-BB.U2006",
"nt1": "B.U2006",
"nt2": "BC.U2006",
"nt3": "BA.U2006",
"nt4": "BB.U2006",
"onz": "O-",
"gbaClassification": "VIIIa",
"planarityDeviation": 0.5029635765888024,
"ionsChannel": ["Na", "Na"],
"ionsOutside": []
}
],
"onzm": "Op*",
"handedness": "right",
"tetradPolarities": ["anticlockwise", "anticlockwise", "anticlockwise", "anticlockwise", "clockwise"],
"strandPolarities": [
["plus", "plus", "plus", "plus", "minus"],
["plus", "plus", "plus", "plus", "minus"],
["plus", "plus", "plus", "plus", "minus"],
["plus", "plus", "plus", "plus", "minus"]
],
"loopClassification": null,
"gbaClassification": ["VIII"],
"tracts": [
["B.G2002", "B.G2003", "B.G2004", "B.G2005", "B.U2006"],
["BC.G2002", "BC.G2003", "BC.G2004", "BC.G2005", "BC.U2006"],
["BA.G2002", "BA.G2003", "BA.G2004", "BA.G2005", "BA.U2006"],
["BB.G2002", "BB.G2003", "BB.G2004", "BB.G2005", "BB.U2006"]
],
"path": ["A1", "B1", "C1", "D1", "E1", "A2", "B2", "C2", "D2", "E2", "A3", "B3", "C3", "D3", "E3", "A4", "B4", "C4", "D4", "E4"],
"bulges": [],
"loops": []
}
],
"tetradPairs": [
{
"tetrad1": "A.U1006-AC.U1006-AA.U1006-AB.U1006",
"tetrad2": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
"direction": "parallel",
"rise": 3.3539318181818345,
"twist": -39.962531742191715
},
{
"tetrad1": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
"tetrad2": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
"direction": "parallel",
"rise": 3.412909090909082,
"twist": 25.896144446319223
},
{
"tetrad1": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
"tetrad2": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
"direction": "parallel",
"rise": 3.3061818181818126,
"twist": 35.81115298630442
},
{
"tetrad1": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
"tetrad2": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
"direction": "parallel",
"rise": 3.3308181818181843,
"twist": 27.115159719868057
},
{
"tetrad1": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
"tetrad2": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
"direction": "parallel",
"rise": 3.349181818181819,
"twist": -28.99318031267558
},
{
"tetrad1": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
"tetrad2": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
"direction": "parallel",
"rise": 3.3993636363636277,
"twist": 27.410084968596863
},
{
"tetrad1": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
"tetrad2": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
"direction": "parallel",
"rise": 3.289363636363646,
"twist": 35.04072146975963
},
{
"tetrad1": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
"tetrad2": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
"direction": "parallel",
"rise": 3.346909090909092,
"twist": 25.14999794993814
},
{
"tetrad1": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
"tetrad2": "B.U2006-BC.U2006-BA.U2006-BB.U2006",
"direction": "parallel",
"rise": 6.888965909090907,
"twist": -43.406094922623346
}
]
}
],
"dotBracket": {
"sequence": "UGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGGU",
"line1": ".([{<-A.)]}>-(.[{<A-).]}>a-a.([{<-A.)]}>-(.[{<A-).]}>aa",
"line2": ".([{<-(.[{<A-).]}>a-A.)]}>-a.([{<-(.[{<A-).]}>a-A.)]}>a"
},
"quadruplexDotBracket": {
"sequence": "UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU",
"structure": ".QRSTu-.qrstU-.QRSTu-.qrstU-.VWXYz-.vwxyZ-.VWXYz-.vwxyZ",
"chi": "aaaaaa-aaaaaa-aaaaaa-aaaaaa-aaaaaa-aaaaaa-aaaaaa-aaaaaa",
"sugar": "NNSNNS-NNSNNS-NNSNNS-NNSNNS-NNSNNN-NNSNNN-NNSNNN-NNSNNN",
"loop": "......-......-......-......-......-......-......-......"
}
}
G4 fold scoring
The src/eltetrado/score_folds.py script scores candidate G4-folding
JSON files (as produced by eltetrado --output) against a reference
JSON file with correct values.
Usage
uv run python src/eltetrado/score_folds.py reference.json cand1.json cand2.json \
[--csv results.csv] [--filter-valid] [--sort {score,file}] [--desc]
Candidates can also be piped via stdin, which is useful when evaluating hundreds of files:
find candidates/ -name '*.json' | \
uv run python src/eltetrado/score_folds.py reference.json - \
--csv results.csv --filter-valid
sort -t, -k3 -nr results.csv # rank valid folds by score
A self-test (the reference scored against itself must yield
valid=True, score=100):
uv run python src/eltetrado/score_folds.py reference.json reference.json
How the score is computed
Validity gate
A candidate is valid only if the multiset of tetrad nucleotide sets —
every {nt1, nt2, nt3, nt4} as an order-insensitive set, across all
quadruplexes in all helices — is exactly identical to the reference.
Invalid folds are capped at a small baseline score (proportional to how
close the quadruplex count is to the reference).
Per-quadruplex score
Reference and candidate quadruplexes are matched 1-1 greedily by tetrad Jaccard overlap. Each matched pair is scored with weighted checks:
| Check | Weight |
|---|---|
| tetrads multiset match | 10 |
gbaClassification per tetrad |
8 |
onz per tetrad |
8 |
planarityDeviation (numeric similarity) |
6 |
handedness |
6 |
loopClassification (classification + loopProgression) |
6 |
tetradPolarities |
5 |
strandPolarities |
5 |
tracts (sets of ordered tracts) |
6 |
path (order-sensitive) |
5 |
quadruplex-level gbaClassification |
5 |
loops (multiset) |
6 |
bulges (multiset) |
4 |
onzm |
4 |
tetradPairs direction |
4 |
tetradPairs rise/twist (numeric, half/half) |
6 |
Numeric checks (planarity deviation, rise, twist) contribute their 0..1 similarity instead of a boolean pass/fail.
Aggregation
Quadruplex scores are averaged, weighted by the number of tetrads in
each reference quadruplex. Dot brackets contribute the remainder: both
dotBracket and quadruplexDotBracket must match exactly to earn those
points. A perfect match yields exactly 100.0.
CSV output
One row per candidate, with columns for validity, score and every
individual check (per-quadruplex metrics are prefixed q0_, q1_, …).
Filter and rank, e.g.:
# valid folds only, best first
uv run python src/eltetrado/score_folds.py ref.json $(ls cands/*.json) \
--csv results.csv --filter-valid
Funding
This research was supported by the National Science Centre, Poland [2016/23/B/ST6/03931, 2019/35/B/ST6/03074] and Mloda Kadra project [09/91/SBAD/0684] from Poznan University of Technology, and carried out in the European Centre for Bioinformatics and Genomics (Poland). The authors also acknowledge partial support by the statutory funds of Poznan University of Technology, Polish Ministry of Science and Higher Education, and the Institute of Bioorganic Chemistry, PAS within intramural financing program.
Bibliography
-
Topology-Based Classification of Tetrads and Quadruplex Structures. M. Popenda, J. Miskiewicz, J. Sarzynska, T. Zok, M. Szachniuk. Bioinformatics. 2020. 36(4):1129–1134. doi:10.1093/bioinformatics/btz738
-
ElTetrado: A Tool for Identification and Classification of Tetrads and Quadruplexes. T. Zok, M. Popenda, M. Szachniuk. BMC Bioinformatics. 2020. 21(1):40. doi:10.1186/s12859-020-3385-1
-
R-Chie : A Web Server and R Package for Visualizing RNA Secondary Structures. D. Lai, J.R. Proctor, J.Y.A. Zhu, I.M. Meyer. Nucleic Acids Research. 2012. 40(12):e95. doi:10/f99845
-
Geometric Nomenclature and Classification of RNA Base Pairs. N.B. Leontis, E. Westhof. RNA. 2001. 7(4):499–512. doi:10.1017/s1355838201002515
1 maintainer
Metadata
1 maintainer
Release files for eltetrado 1.10.3
For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.
Source distribution (sdist)
| File | Size | Uploaded | |
|---|---|---|---|
| eltetrado-1.10.3.tar.gz | 62.9 kB | Details |
Built distribution (wheel)
| File | Interpreter | ABI | Platform | Reset |
|---|---|---|---|---|
| eltetrado-1.10.3-py3-none-any.whl | Python 3 | none | any | Details |
Total release size: 118.8 kB
Release files / eltetrado-1.10.3.tar.gz
| Download URL | eltetrado-1.10.3.tar.gz |
|---|---|
| Size | 62.9 kB |
| Tags | Source |
|
SHA-256 checksum How to use checksums |
d71d9edb1f19b033087a6d2bbc42c525c8a90c848e1692a3283b84ec1fe2d746
|
|
BLAKE2b-256 checksum How to use checksums |
6858db1a30b234c97eaeb92ff1af3aa40bfdd8bf5f1df17290d5291c5672e4cf
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
uv/0.9.30 {"installer":{"name":"uv","version":"0.9.30","subcommand":["publish"]},"python":null,"implementation":{"name":null,"version":null},"distro":{"name":"Ubuntu","version":"24.04","id":"noble","libc":null},"system":{"name":null,"release":null},"cpu":null,"openssl_version":null,"setuptools_version":null,"rustc_version":null,"ci":true}
|
Release files / eltetrado-1.10.3-py3-none-any.whl
| Download URL | eltetrado-1.10.3-py3-none-any.whl |
|---|---|
| Size | 55.9 kB |
| Tags | Python 3 |
|
SHA-256 checksum How to use checksums |
9f6897ef3f0fc277856598d03e67a2fe4e7f75777e10198d320c54129d2c1a68
|
|
BLAKE2b-256 checksum How to use checksums |
a6937499ded6bae13e65e90597cdd24dddeb68b7f08611ba1ff4fb73ebdd4371
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
uv/0.9.30 {"installer":{"name":"uv","version":"0.9.30","subcommand":["publish"]},"python":null,"implementation":{"name":null,"version":null},"distro":{"name":"Ubuntu","version":"24.04","id":"noble","libc":null},"system":{"name":null,"release":null},"cpu":null,"openssl_version":null,"setuptools_version":null,"rustc_version":null,"ci":true}
|
