Skip to main content

An interface to the Ensembl REST APIs, biological data at your fingertips.

Project description

Ensembl-REST


A Python interface to the Ensembl REST APIs. A whole world of biological data

at your fingertips.

The Ensembl database contains

reference biological data on almost any organism. Now it is easy to

access this data programatically through their REST API.

The full list of endpoints for the Ensembl REST API endpoints along with

endpoint-specific documentation can be found on their website.

This library also includes some utilities built on top of the APIs designed to

ease working with them, including an AssemblyMapper

class that helps in the conversion between different genome assemblies.

This project uses code from RESTEasy

which made my life much easier. Thanks!

Installation


You can install from PyPI

$ pip install ensembl_rest

Examples


The library exports methods that point to each endpoint of the

API, such as:

>>> import ensembl_rest



>>> ensembl_rest.symbol_lookup(

        species='homo sapiens',

        symbol='BRCA2'

    )
{ 'species': 'human',

  'object_type': 'Gene',

  'description': 'BRCA2, DNA repair associated [Source:HGNC Symbol;Acc:HGNC:1101]',

  'assembly_name': 'GRCh38',

  'end': 32400266,

  ...

  ...

  ...

  'seq_region_name': '13',

  'strand': 1,

  'id': 'ENSG00000139618',

  'start': 32315474}

All the endpoints are listed on the API website.

A quick lookup of the methods can be obtained by calling help on the module:

>>> help(ensembl_rest)

If you want to use an endpoint from the ones enlisted in the API website,

say GET lookup/symbol/:species/:symbol ,

then the name of the corresponding method is in the endpoint documentation URL,

in this case, the documentation links to

http://rest.ensembl.org/documentation/info/symbol_lookup so the

corresponding method name is symbol_lookup.

>>> help(ensembl_rest.symbol_lookup)
Help on function symbol_lookup in module ensembl_rest:



symbol_lookup(*args, **kwargs)

        Lookup ``GET lookup/symbol/:species/:symbol``



    Find the species and database for a symbol in a linked external database





    **Parameters**



    - Required:

            + **Name**:  species

            + *Type*:  String

            + *Description*:  Species name/alias

            + *Default*:  -

            + *Example Values*:  homo_sapiens, human

    ...

    ...



    - Optional:



            + **Name**:  expand

            + *Type*:  Boolean(0,1)

            + *Description*:  Expands the search to include any connected features. e.g. If the object is a gene, its transcripts, translations and exons will be returned as well.

    ...

    ...



    **Resource info**



    - **Methods**:  GET

    - **Response formats**: json, xml, jsonp





    **More info**



    https://rest.ensembl.org/documentation/info/symbol_lookup

We can see from the resource string GET lookup/symbol/:species/:symbol that

this method contains 2 parameters called species and symbol, so we can call the

method in the following way:

>>> ensembl_rest.symbol_lookup(

        species='homo sapiens',

        symbol='TP53'

    )



# Or like this...

>>> ensembl_rest.symbol_lookup('homo sapiens', 'TP53')
{'source': 'ensembl_havana',

  'object_type': 'Gene',

  'logic_name': 'ensembl_havana_gene',

 ...

 ...

 ...

  'start': 32315474}

One can provide optional parameters with the params

keyword (the specific parameters to pass depend on the specific endpoint,

the official endpoints documentation can be found here)_:

# Fetch also exons, transcripts, etc...

>>> ensembl_rest.symbol_lookup('human', 'BRCA2',

                               params={'expand':True})
{'source': 'ensembl_havana',

 'seq_region_name': '13',

 'Transcript': [{'source': 'ensembl_havana',

   'object_type': 'Transcript',

   'logic_name': 'ensembl_havana_transcript',

   'Exon': [{'object_type': 'Exon',

     'version': 4,

     'species': 'human',

     'assembly_name': 'GRCh38',

     ...

     ...

     ...

 'biotype': 'protein_coding',

 'start': 32315474}

The parameters for the POST endpoints are also provided via the params

keyword , such as in the next example:

>>> ensembl_rest.symbol_post(species='human',

                             params={'symbols': ["BRCA2",

                                                 "TP53",

                                                 "BRAF" ]})
{

    "BRCA2": {

        "source": "ensembl_havana",

        "object_type": "Gene",

        "logic_name": "ensembl_havana_gene",

        "description": "BRCA2, DNA repair associated [Source:HGNC Symbol;Acc:HGNC:1101]",

        ...

        ...

    },

    "TP53": {

        ...

        ...

    }.

    "BRAF": {

        ...

        ...

        "strand": -1,

        "id": "ENSG00000157764",

        "start": 140719327

    }

}

Another common usage is to fetch sequences of known genes:

>>> ensembl_rest.sequence_id('ENSG00000157764')
{'desc': 'chromosome:GRCh38:7:140719327:140924928:-1',

 'query': 'ENSG00000157764',

 'version': 13,

 'id': 'ENSG00000157764',

 'seq': 'TTCCCCCAATCCCCTCAGGCTCGG...ATTGACTGCATGGAGAAGTCTTCA',

 'molecule': 'dna'}

if you want it in FASTA, you can modify the headers:

>>> ensembl_rest.sequence_id(

        'ENSG00000157764',

        headers={'content-type': 'text/x-fasta'})
>ENSG00000157764.13 chromosome:GRCh38:7:140719327:140924928:-1

TTCCCCCAATCCCCTCAGGCTCGGCTGCGCCCGGGGCCGCGGGCCGGTACCTGAGGTGGC

CCAGGCGCCCTCCGCCCGCGGCGCCGCCCGGGCCGCTCCTCCCCGCGCCCCCCGCGCCCC

CCGCTCCTCCGCCTCCGCCTCCGCCTCCGCCTCCCCCAGCTCTCCGCCTCCCTTCCCCCT

...

Notice that, if left unchanged, the methods ask for data in dictionary (JSON)

format so that they are easy to use. If the response cannot be decoded as such,

then it is returned as plain text, such as the above.

You can also map betweeen assemblies…

>>> ensembl_rest.assembly_map(species='human',

                              asm_one='GRCh37',

                              region='X:1000000..1000100:1',

                              asm_two='GRCh38')





# Or...

>>> region_str = ensembl_rest.region_str(chrom='X',

                                         start=1000000,

                                         end=1000100)



>>> ensembl_rest.assembly_map(species='human',

                              asm_one='GRCh37',

                              region=region_str,

                              asm_two='GRCh38')
{'mappings': [{'original': {'seq_region_name': 'X',

    'strand': 1,

    'coord_system': 'chromosome',

    'end': 1000100,

    'start': 1000000,

    'assembly': 'GRCh37'},

   'mapped': {'seq_region_name': 'X',

    'strand': 1,

    'coord_system': 'chromosome',

    'end': 1039365,

    'start': 1039265,

    'assembly': 'GRCh38'}}]}

The above problem (mapping from one assembly to another) is so frequent that

the library provides a specialized class AssemblyMapper to efficiently

mapping large amounts of regions between assemblies. This class avoids the

time-consuming task of making a web request every time a mapping is needed by

fetching the mapping of the whole assembly right from the instantiation. This

is a time-consuming operation by itself, but it pays off when one has to

transform repeatedly betweeen assemblies.:

>>> mapper = ensembl_rest.AssemblyMapper(

                species='human',

                from_assembly='GRCh37',

                to_assembly='GRCh38'

            )



>>> mapper.map(chrom='1', pos=1000000)

1064620

You can also find orthologs, paralogs and gene tree information, along with

variation data and basically everything Ensembl

has to offer.

If you want to instantiate your own client, you can do it by using the

ensembl_rest.EnsemblClient class, this class is the one that contains all

the endpoint methods.

>>> client = ensembl_rest.EnsemblClient()



>>> client.symbol_lookup('homo sapiens', 'TP53')
{'source': 'ensembl_havana',

  'object_type': 'Gene',

  'logic_name': 'ensembl_havana_gene',

  'version': 14,

  'species': 'human',

  ...

  ...

  ...}

Finally, the library exposes the class ensembl_rest.HTTPError that allows to

handle errors in the requests. An example of it’s utility is when using the

GET genetree/member/symbol/:species/:symbol endpoint to query for gene trees

in order to find ortholog and paralog proteins and genes. This endpoint returns

an HTTP error when a gene tree is not found with code 400 and the error message

Lookup found nothing. We can use this information to detect the error

and handle it, or to simply ignore it if we expected it:

for gene in ['TP53', 'rare-new-gene', 'BRCA2']:

    try:

        gene_tree = ensembl_rest.genetree_member_symbol(

                        species='human',

                        symbol=gene,

                        params={'prune_species': 'human'}

                    )

        # Assuming we have a function to extract the paralogs

        paralogs = extract_paralogs(gene_tree['tree'])

        print(paralogs)



    # Handle the case when there's no gene tree

    except ensembl_rest.HTTPError as err:

        error_code = err.response.status_code

        error_message = err.response.json()['error']

        if (error_code == 400) \

           and ('Lookup found nothing' in error_message):

            # Skip the gene with no data

            pass

        else:

            # The exception was caused by another problem

            # Raise the exception again

            raise

Meta


Author: Ad115 -

Githuba.garcia230395@gmail.com

Project pages:

Docs - @GitHub - @PyPI

Distributed under the MIT license. See

LICENSE

for more information.

Contributing


  1. Check for open issues or open a fresh issue to start a discussion

    around a feature idea or a bug.

  2. Fork the repository

    on GitHub to start making your changes to a feature branch, derived

    from the master branch.

  3. Write a test which shows that the bug was fixed or that the feature

    works as expected.

  4. Send a pull request and bug the maintainer until it gets merged and

    published.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

ensembl_rest-0.3.4.tar.gz (34.7 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

ensembl_rest-0.3.4-py3-none-any.whl (30.3 kB view details)

Uploaded Python 3

File details

Details for the file ensembl_rest-0.3.4.tar.gz.

File metadata

  • Download URL: ensembl_rest-0.3.4.tar.gz
  • Upload date:
  • Size: 34.7 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/4.0.2 CPython/3.11.4

File hashes

Hashes for ensembl_rest-0.3.4.tar.gz
Algorithm Hash digest
SHA256 67b6c5b033583c531caba062646e1e93d2728a3fcc0731265c421184ab30acb3
MD5 f6994a9a4d5a3dc8edc67fb557a8c396
BLAKE2b-256 336f090470711301b02ded0bcc29f1b70a5e55ca4a1d65d63b3f81c4b21da6e9

See more details on using hashes here.

File details

Details for the file ensembl_rest-0.3.4-py3-none-any.whl.

File metadata

  • Download URL: ensembl_rest-0.3.4-py3-none-any.whl
  • Upload date:
  • Size: 30.3 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/4.0.2 CPython/3.11.4

File hashes

Hashes for ensembl_rest-0.3.4-py3-none-any.whl
Algorithm Hash digest
SHA256 7e48acf8e01cff42adf36765eb4a266e61f0e7a861f58e7ef3164a46fff9002e
MD5 8af341e718a0e10beb1249afee6c665e
BLAKE2b-256 7afe2711b061bd4aaf84f20ea14c2353bbe1736b983efcb1f12652bbff997ea9

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page