Deep learning for biological sequences with fastai
Project description
Welcome to fastBio
fastBio is a package for manipulating data and creating and training deep learning models for biological sequencing data. It is an extension of the fastai v1 library.
A number of pretrained models for biological sequencing data can be loaded directly through fastBio with the LookingGlass and LookingGlassClassifier classes. These models are available for download at the sister repository LookingGlass.
If you find fastBio or LookingGlass useful, please cite the preprint:
Hoarfrost, A., Aptekmann, A., Farfanuk, G. & Bromberg, Y. Shedding Light on Microbial Dark Matter with A Universal Language of Life. bioRxiv (2020). doi:10.1101/2020.12.23.424215. https://www.biorxiv.org/content/10.1101/2020.12.23.424215v2.
Installation
You can install fastBio with pip (python 3 only):
pip3 install fastBio
Docs
The docs for the fastBio package are here.
Tutorial
You can run the following tutorial in a jupyter notebook by downloading the notebook in this repository.
import fastBio
Steps to training a model
In fast.ai, there are three basic steps to training a deep learning model:
-
Define your transforms (for sequences/text, this means defining the tokenizer and vocabulary you will use for tokenization and numericalization)
-
Create a Databunch (which wraps up a Pytorch Dataset and Dataloader into one)
-
Create a Learner with your specified model config
and train!
If fastai v1 is new to you, I recommend taking a look at their very extensive documentation, forum, and online course. Note fastBio uses fastai v1, which isn't compatible with the new fastai v2.
Biological sequence data asks for some special treatment as compared to text (kmer-based tokenization; handling sequence file types like fasta/fastq), so while we can use much of the built-in fast.ai text functionality, fastBio provides some helper functions and classes to deal with some of the quirks of biological data.
create tokenizer and vocabulary for transforming seq data
from fastBio import BioTokenizer, BioVocab
#define a tokenizer with the correct kmer size and stride for your data
tok = BioTokenizer(ksize=1, stride=1)
tok
BioTokenizer with the following special tokens:
- xxunk
- xxpad
- xxbos
- xxeos
The kmer size is how many nucleotides constitute a 'word' in the sequence, and the stride is the number of nucleotides to skip between tokens.
So for a sequence: ACGGCGCTC
a kmer size of 3 and stride of 1 would result in the tokenized sequence: ['ACG','CGG','GGC','GCG','CGC','GCT','CTC']
whereas a kmer size of 3 and stride of 3 would result in: ['ACG','GCG','CTC']
create vocab from scratch
model_voc = BioVocab.create_from_ksize(ksize=1)
print(model_voc.itos)
model_voc.stoi
['xxunk', 'xxpad', 'xxbos', 'xxeos', 'T', 'G', 'C', 'A']
defaultdict(int,
{'xxunk': 0,
'xxpad': 1,
'xxbos': 2,
'xxeos': 3,
'T': 4,
'G': 5,
'C': 6,
'A': 7})
Above I created a vocabulary using a kmer size of 1 (so just the nucleotides A, C, T, G), but you can use larger kmer sizes as well:
model_voc = BioVocab.create_from_ksize(ksize=2)
print(model_voc.itos)
model_voc.stoi
['xxunk', 'xxpad', 'xxbos', 'xxeos', 'CC', 'GA', 'AG', 'CG', 'CT', 'TC', 'TT', 'TG', 'GG', 'GT', 'CA', 'GC', 'AC', 'AT', 'TA', 'AA']
defaultdict(int,
{'xxunk': 0,
'xxpad': 1,
'xxbos': 2,
'xxeos': 3,
'CC': 4,
'GA': 5,
'AG': 6,
'CG': 7,
'CT': 8,
'TC': 9,
'TT': 10,
'TG': 11,
'GG': 12,
'GT': 13,
'CA': 14,
'GC': 15,
'AC': 16,
'AT': 17,
'TA': 18,
'AA': 19})
Or download the predefined LookingGlass vocabulary
For training the LookingGlass model, I used a ksize=1, stride=1. If you're using a pretrained LookingGlass-based model, you want to make sure that your vocabulary is in the same order so that numericalization is the same for your data as for the LookingGlass weights.
Or, it's easy to simply download the LookingGlass vocabulary for this purpose:
#or download from pretrained vocab used in LookingGlass
#you might need this if you are me...
import ssl
ssl._create_default_https_context = ssl._create_unverified_context
import urllib.request
urllib.request.urlretrieve ("https://github.com/ahoarfrost/LookingGlass/releases/download/v1.0/ngs_vocab_k1_withspecial.npy", "ngs_vocab_k1_withspecial.npy")
import numpy as np
voc = np.load('ngs_vocab_k1_withspecial.npy')
model_voc = BioVocab(voc)
print(model_voc.itos)
model_voc.stoi
['xxunk' 'xxpad' 'xxbos' 'xxeos' 'G' 'A' 'C' 'T']
defaultdict(int,
{'xxunk': 0,
'xxpad': 1,
'xxbos': 2,
'xxeos': 3,
'G': 4,
'A': 5,
'C': 6,
'T': 7})
Notice that the order of the nucleotides in the vocabulary is different than the one that we generated from scratch; if you're using the pretrained LookingGlass-based models, make sure you're using the LookingGlass vocab described here as well.
create a databunch
You can create a databunch using the BioLMDataBunch (for language modeling) or BioClasDataBunch (for classification). You can do this from raw sequence data fasta/fastq files or csv files:
- from_folder
- from_seqfile
- from_df
- from_multiple_csv
You will probably want to create a BioLMDataBunch from_folder (which will include all sequences from a folder containing multiple fasta/fastq files), or from_seqfile (all sequences from a single fasta or fastq file).
For a BioClasDataBunch, I find it easiest in practice to convert sequence files like fasta/fastq to csv files with the label in a column and the sequence in another column, and use from_df or from_multiple_csv, rather than use from_seqfile or from_folder. Alternatively, you can use the BioTextList class to go straight from sequence files.
You can create a custom databunch, a la the fast.ai data block API, using the BioTextList class, which provides a few extra specialized labeling functions etc. If you must use sequence files for classification, for example, you can provide a fairly complicated regex-based function to use fastai's label_from_func, or create a BioTextList.from_folder and use label_from_fname or label_from_header in the BioTextList class to extract labels from a filename or fasta header, for instance.
BioLMDataBunch example
Here we'll download some toy metagenomes (a small subset of sequences from 6 marine metagenomes from the TARA project), split them into 'train' and 'valid' folders, and create a BioLMDataBunch:
from fastBio import BioLMDataBunch
#these are 1000 random sequences from 6 marine metagenomes from the TARA project:
from pathlib import Path
Path('./lmdata/train').mkdir(parents=True, exist_ok=True)
Path('./lmdata/valid').mkdir(parents=True, exist_ok=True)
for srr in ['ERR598981','ERR599020','ERR599039','ERR599052']:
print('downloading',srr,'...')
'https://raw.githubusercontent.com/ahoarfrost/fastBio/master/example_data/TARA_cut1000/'+srr+'_cut1000.fastq'
url = 'https://raw.githubusercontent.com/ahoarfrost/fastBio/master/example_data/TARA_cut1000/'+srr+'_cut1000.fastq'
urllib.request.urlretrieve (url, Path('./lmdata/train/'+srr+'_cut1000.fastq'))
for srr in ['ERR599063','ERR599115']:
print('downloading',srr,'...')
url = 'https://raw.githubusercontent.com/ahoarfrost/fastBio/master/example_data/TARA_cut1000/'+srr+'_cut1000.fastq'
urllib.request.urlretrieve (url, Path('./lmdata/valid/'+srr+'_cut1000.fastq'))
data_path = Path('./lmdata/')
train_path = Path('./train/') #relative to data_path
valid_path = Path('./valid/')
data_outfile = Path('metagenome_LMbunch.pkl')
#define your batch size, ksize, and bptt
bs=512
bptt=100
ksize=1
max_seqs=None #None or int to optionally limit the number of sequences read from each file in training
val_max_seqs=None #same for valid set
skiprows = 0 #0 or int to optionally skip X sequences in the beginning of the file before reading into the databunch
val_skiprows = 0 #same for valid set
#these will default to the parameters chosen here, we don't technically need to pass them
#using tok and model_voc defined above
#create new training chunk
print('creating databunch')
lmdata = BioLMDataBunch.from_folder(path=data_path,
train=train_path, valid=valid_path, ksize=ksize,
tokenizer=tok, vocab=model_voc,
max_seqs_per_file=max_seqs, val_maxseqs=val_max_seqs,
skiprows=skiprows, val_skiprows=val_skiprows,
bs=bs, bptt=bptt
)
print('there are',len(lmdata.items),'items in itemlist, and',len(lmdata.valid_ds.items),'items in lmdata.valid_ds')
print('databunch preview:')
print(lmdata)
#you can save your databunch to file like so:
lmdata.save(data_outfile)
there are 4000 items in itemlist, and 2000 items in lmdata.valid_ds
databunch preview:
BioLMDataBunch;
Train: LabelList (4000 items)
x: BioLMTextList
xxbos A T T A A A G A T A T C A A T G C G T A A A T C T T T A T T C T T A A T A T T A A T A T C T T A T T C A T T A T C A A T A T T T A G T T T T G A A T T T A G T G T T A T G A C C C T A A A T G C T C A A A,xxbos T G C T T T A A T T C G A T G G G T A A A T A A G C C T xxunk A T C A T T C T T T T T T G G G T C A T C A A T C G T A T C A A,xxbos T G T T A A A G C A A T A G G C A G T G A A G C A G A A G G C A G T C T C A C T G G A G T G C A C A C A G G T T T A A T G G G T T T G G G T T T C A T T A T A G G C A C G A T A A G C A T T G G A T T T G,xxbos T T T A T G T C C C T G G C T G C C A T G A A A C G G T xxunk T A C A A C A A A A G G C T G T C C C G G A T A G C C A A A T C,xxbos C C A T T A G A G T T T G T T G T T G A G T A A G T A T A A G C T C C T G A A C T T G T A T A A G T T G T T C C A T T C C A A C T A T A A G A A T C A C A A G A A G T A T G T G T A G T T G C A G A T G T
y: LMLabelList
,,,,
Path: /Users/adrienne/Projects/fastBio/lmdata/train;
Valid: LabelList (2000 items)
x: BioLMTextList
xxbos A T T T T A A A G C A T A T G G T A G T A A A G G T A T T T C T T C C A A T A A A C T A C T T A G T C T G G G G A T T A A A G A T T T T C A C C G A A G T T T C C G A A T T G A A A A C A T T T C T C A A,xxbos T T T T C T T G A C T A T T T C C T T G G G C T C C A A C C A A A T A G G G G G C G A G C T T G G C G T A G G T G T T T T G A G A A A T G T T T T C A A T T C G G A A A C T T C G G T G A A A A T C T T T,xxbos T G C A A A A T C T T A T A C T A A A A T T G G T G A A A A T G T A A A A G A A G G C A T C T T T T T A C A T T A A A C T A A A A G A C G T G T T A A A C T A T T G A A A G A A G A A T T A A A A A A A,xxbos T A T T T T A T A T T C T A T A T C T T T T A C A T G T A T A G T T T C A T C T T T T C C T T T G T A A G T A A A C T T A A T A A T A C T A T G T T T T T T T A A T T C T T C T T T C A A T A G T T T A A,xxbos C T A G A C T T T T T T A T T C C T A A T T T C A A T T T T T C A T A T T T A T C T G A T G C T A G A T T T T T T A A A T C A T T A
y: LMLabelList
,,,,
Path: /Users/adrienne/Projects/fastBio/lmdata/valid;
Test: None
BioClasDataBunch example
Here we'll download sequences that I've preprocessed: downloading the coding sequences of three genomes, splitting them into read-length chunks, and recording that sequence, along with the label of the known reading frame from the coding sequence, in a csv file for each sequence. The sequence is in a column named 'seq' and the label is in a column named 'frame'.
We'll split these csv files into train and valid folders and create a BioClasDataBunch from_multiple_csv
from fastBio import BioClasDataBunch
from pathlib import Path
Path('./clasdata/train').mkdir(parents=True, exist_ok=True)
Path('./clasdata/valid').mkdir(parents=True, exist_ok=True)
for genome in ['GCA_000007025.1_ASM702v1','GCA_000008685.2_ASM868v2']:
print('downloading',genome,'...')
url = 'https://github.com/ahoarfrost/fastBio/raw/master/example_data/FrameClas_sample/'+genome+'.csv'
urllib.request.urlretrieve (url, Path('./clasdata/train/'+genome+'.csv'))
url = 'https://github.com/ahoarfrost/fastBio/raw/master/example_data/FrameClas_sample/GCA_000011445.1_ASM1144v1.csv'
print('downloading GCA_000011445.1_ASM1144v1...')
urllib.request.urlretrieve (url, Path('./clasdata/valid/GCA_000011445.1_ASM1144v1.csv'))
data_path = Path('./clasdata/')
train_path = Path('./clasdata/train/')
valid_path = Path('./clasdata/valid/')
data_outfile = Path('frameclas_bunch.pkl')
#use tok and model_voc defined above again
#you can optionally limit the number of sequences you read (and how many rows to skip in the csv)
framedata = BioClasDataBunch.from_multiple_csv(path=data_path, train=train_path, valid=valid_path,
text_cols='seq', label_cols='frame',
tokenizer=tok, vocab=model_voc,
#let's limit the number of sequences for this toy example
max_seqs_per_file=1000, valid_max_seqs=500, skiprows=0, bs=512
)
print('there are',len(framedata.items),'items in itemlist, and',len(framedata.valid_ds.items),'items in data.valid_ds')
print('there are',framedata.c,'classes')
print('databunch preview:')
print(framedata)
#you can save your databunch to file like so:
framedata.save(data_outfile)
there are 2000 items in itemlist, and 500 items in data.valid_ds
there are 6 classes
databunch preview:
TextClasDataBunch;
Train: LabelList (2000 items)
x: BioTextList
xxbos A G T T A A A T C G A T T T G G G T T C C A A T A A A A A A T T T T A T A G C A A G T G T A T C A G T T A A A A T T G A A T A C T T G G T A A T G T A A A T A G T G A A A G C T A A A T T G A A A T A,xxbos A A A G A A G T C G A T A A T T T A T A G T A A A T A C T A T A G T T A T T A G G T A T G A A A T C A A T T T C A A A T T T G A A G G T A A T T A T G G G A A G A A T T G G A T A G A G A A A T G C A T G A G T T G T T T T T C C T G T A A A T A T A G T A G T T C T C A G,xxbos A A T G A A G T A T A G T G C T A T T T T A T T A A T A T G T A G C G T T A A T T T A T T T T G T T T T C A A A A T A A A T T A A C T A C T T C T C G A T G G G A A T T C C C T A A A G A A G A T T T A A T T A A A A A A A A A A T A A A A A T A G G C A T A A T T T A C C A T A A T T A C A T A A A T T C T A T C T T T T A C A A T G A A A A T T A T A A A T A C A T T G C C T T T A T C G G A A T A T T G A C A T C T T A T A A T G A A T G G A T T G A A A T A C A A T T T A G C C C C A T A A A T T T T T T T A C T A T C C C A A C A A A T A A A G A T T T T A T T T C A A A T A C T,xxbos C T A A T A T T G A A A A T G C T A T T A A A A A G T C T T T G A G T T C G G G T G T C A A T A T A G T A C T C A T T C C T T A G,xxbos T T G C A T C T T A T T T A T A A A A T T G G T G A A G T T C T T G C T A A A C A A T T G C G T A G A T T G G G T A T T A A T T T A A A T A T G G C T C C A G T T G C C G A T A T A A A A T T T G C A C C A C A T A C T C C T T T A T T A A A T A G G A C A T T T G G A G G A T A T T C C G C T T A T A A T
y: CategoryList
-1,-1,2,3,1
Path: /Users/adrienne/Projects/fastBio/clasdata;
Valid: LabelList (500 items)
x: BioTextList
xxbos A T C T C T A C C A C C A A A T T C T T C T C C A A T T T G A G C T A A A G T G T G A T T T A A G A T C T C T T T T G T T A A A A A C A T T G C T A T A T G T C T T G C T G T T A C A A T T G A C T T A,xxbos A A G C T T T T A T A G C A G T T C A A A C C G T A A G T A A A A A T C C T G G A A T T T C T T A T A A T C C A T T G T T T A T T T A T G G T G A A T C T G G A A T G G G A A A A A C T C A T T T A T T A A A A G C T G C A A A A A A C T A T A T T G A A T C T A A T T T T T C T G A T C T A A A A G T T A,xxbos G T T C A T T A C T T G C A C C G A T T A C A A A A T T T T C A A A T G T G T T T T C A T T A A T T T T T T T A A C T T T T T T A G T G A T G A T A T C A G A A T G A T C T T T T T T G A T T A A T T C A T C T T T T T C T A G T T G T T T T T T A T A T T C T T G T T C G T A T G T A A A A C T A A T A T T,xxbos T T T A A A A T A C C T A A T T T T G A A G T A G G T A T A T C T C T A A A C A G A T C A G A A A C T A T T T C T A T A G T A A T A A T T T T T T C T T C T G G A T T T T G T T G A G A T C A A A A G T T T A A T C T T G A A A C A C T T C C T T T A A T T T T T C T A A C A T C A T C T G A A T A A T A A,xxbos T G T T A A A A A A A T T A A A G A A G T T G T T A G T G A A A A A T A T G G T A T T T C A G T T A A T G C A A T T G A T G G A A A A G C T A G A A G
y: CategoryList
-2,3,-1,-2,2
Path: /Users/adrienne/Projects/fastBio/clasdata;
Test: None
create a learner and train
You can now create a fastai 'learner' with your databunch and train!
There's nothing special in fastBio you need to create a learner - you can use get_language_model or get_text_classifier and any model config you want (see the fastai and pytorch docs for this).
To use LookingGlass architecture (with or without pretrained weights), use the LookingGlass or LookingGlassClassifier classes which maintain the architecture used for the LookingGlass models and associated transfer learning tasks.
There are several pretrained models available through the LookingGlass release, which can be loaded by name in the LookingGlass and LookingGlassClassifier classes.
Make sure to use pretrained=False if you're not using a pretrained model (pretrained=True by default).
Language model
Let's use our BioLMDataBunch to train a language model with the same architecture as LookingGlass:
from fastBio import LookingGlass
from scratch (no pretrained weights)
lmlearn = LookingGlass(data=lmdata).load(pretrained=False)
#adjusting batch size down for my laptop
lmlearn.data.batch_size = 64
lmlearn.fit_one_cycle(5)
| epoch | train_loss | valid_loss | accuracy | time |
|---|---|---|---|---|
| 0 | 1.592360 | 1.451439 | 0.302540 | 06:35 |
| 1 | 1.460893 | 1.411753 | 0.310217 | 06:58 |
| 2 | 1.421647 | 1.402959 | 0.316920 | 07:04 |
| 3 | 1.407578 | 1.399795 | 0.329194 | 06:53 |
| 4 | 1.403432 | 1.399376 | 0.330121 | 06:51 |
using a pretrained model
Using pretrained=True with LookingGlass.load() will load the 'LookingGlass' language model pretrained weights.
#create LookingGlass() model from databunch defined above
lmlearn2 = LookingGlass(data=lmdata).load(pretrained=True, pretrained_dir='models')
downloading pretrained model to models/LookingGlass.pth
loading pretrained LookingGlass language model
Classifier
Let's use our BioClasDataBunch to create and train a classifier with the same encoder architecture as LookingGlass to predict the reading frame of a DNA sequence.
LookingGlassClassifier has two ways to load a model:
-
load()
-
load_encoder()
If using pretrained=False, load() and load_encoder() both create the same classifier with a LookingGlass-like encoder and classification decoder.
If using pretrained=True, load and load_encoder differ in the pretrained models that can be loaded:
-
load_encoder - 'LookingGlass_enc' (default), or 'FunctionalClassifier_enc'
-
load - 'FunctionalClassifier', 'OxidoreductaseClassifier', 'OptimalTempClassifier', or 'ReadingFrameClassifier'
These models are described in the preprint.
from fastBio import LookingGlassClassifier
from scratch (no pretrained weights)
framelearn = LookingGlassClassifier(data=framedata).load(pretrained=False)
#decrease batch size for my laptop
framelearn.data.batch_size = 128
framelearn.fit_one_cycle(5)
| epoch | train_loss | valid_loss | accuracy | time |
|---|---|---|---|---|
| 0 | 1.837610 | 1.793275 | 0.162000 | 03:52 |
| 1 | 1.769472 | 1.782107 | 0.184000 | 03:39 |
| 2 | 1.688373 | 1.776759 | 0.172000 | 03:24 |
| 3 | 1.631552 | 1.620592 | 0.270000 | 03:24 |
| 4 | 1.600325 | 1.555967 | 0.294000 | 03:22 |
We have pretty limited data here, so we don't get great performance. Let's try loading the pretrained LookingGlass encoder and see if we can fine tune it to do any better:
with the pretrained 'LookingGlass' encoder
framelearn2 = LookingGlassClassifier(data=framedata).load_encoder(pretrained_name='LookingGlass_enc',
pretrained=True,
pretrained_dir='models')
downloading pretrained model to models/LookingGlass_enc.pth
loading classifier with pretrained encoder from models/LookingGlass_enc.pth
#decrease batch size for my laptop
framelearn2.data.batch_size = 128
framelearn2.fit_one_cycle(5)
| epoch | train_loss | valid_loss | accuracy | time |
|---|---|---|---|---|
| 0 | 1.821647 | 1.794491 | 0.238000 | 01:11 |
| 1 | 1.655392 | 1.745429 | 0.280000 | 01:13 |
| 2 | 1.470321 | 1.612899 | 0.376000 | 01:13 |
| 3 | 1.328448 | 1.432560 | 0.528000 | 01:11 |
| 4 | 1.241135 | 1.250988 | 0.548000 | 01:11 |
We do much better, but of course we still don't have much data (and we're not using our tricks like gradual training of layers) so our performance isn't yet amazing, and we're starting to overfit.
Luckily, there's an existing pretrained model for exactly this classification task, the 'ReadingFrameClassifier', that we can use:
using the pretrained ReadingFrameClassifier model
framelearn3 = LookingGlassClassifier(data=framedata).load(pretrained_name='ReadingFrameClassifier',
pretrained=True,
pretrained_dir='models')
downloading pretrained model to models/ReadingFrameClassifier.pth
loading pretrained classifier from models/ReadingFrameClassifier.pth
#decrease batch size for my laptop
framelearn3.data.batch_size = 128
framelearn3.fit_one_cycle(1)
| epoch | train_loss | valid_loss | accuracy | time |
|---|---|---|---|---|
| 0 | 0.060926 | 0.189241 | 0.944000 | 01:19 |
much better! Although we're already pretty overfit, so we probably should have just gone straight into using the pretrained model for inference rather than further training.
We can do that with framelearn3.predict() or .pred_batch(), or we can load an exported model for inference like so:
I don't want to deal with all the databunch/training stuff. What if I really just want to make a handful of predictions on some data with a pretrained model?
You can do that! Pretrained models for LookingGlass and associated transfer learning tasks can be downloaded in release v1 of LookingGlass. The ones that end in 'export.pkl' were saved using the fastai 'export' function and can be loaded (with empty databunches) with the fastai load_learner function and used for inference directly:
#download the pretrained oxidoreductase classifier to 'models' folder
import urllib.request
urllib.request.urlretrieve ('https://github.com/ahoarfrost/LookingGlass/releases/download/v1.0/OxidoreductaseClassifier_export.pkl',
'models/OxidoreductaseClassifier_export.pkl')
('models/OxidoreductaseClassifier_export.pkl',
<http.client.HTTPMessage at 0x7ffd52420ef0>)
#load the model (with an empty databunch)
from fastai.text import load_learner
oxido = load_learner(Path('./models').resolve(), 'OxidoreductaseClassifier_export.pkl')
Now let's make some predictions for reads in one of our toy metagenomes we downloaded earlier:
from Bio import SeqIO
for ix,record in enumerate(SeqIO.parse('lmdata/valid/ERR599115_cut1000.fastq','fastq')):
seq = str(record.seq)
if ix < 20:
print('sequence:',seq)
print('prediction:',oxido.predict(seq))
print('---------')
else:
break
sequence: GGGTTGCCAGGTCGACGAGCACGACGACGGCTCGAAGAGCGGTTGGTGCGAGGACGGCACCGGTTGGTGG
prediction: (Category nonec1, tensor(1), tensor([0.0130, 0.9870]))
---------
sequence: CTGGTTCCATCATCGTAGGAGTCGGTGGAACAGCCAGTCTCCTCGTCGTAGCTGTAGACGGGCGGAGCCCAGGACTCCTGCACACCCTCGGCGTCCTCC
prediction: (Category nonec1, tensor(1), tensor([0.0024, 0.9976]))
---------
sequence: TTCAGAATAATCAACTCCATCAATATCCCAGCCACATCCTGATAAATATTGACATTGATCATCCGCATAACCCACGCCTAAATACATGTCACACCAGCC
prediction: (Category nonec1, tensor(1), tensor([0.4787, 0.5213]))
---------
sequence: TGGANAGACGCCTATTTGGGTTGCAGAGTGTCCTGAAAATGGTGATTGCATGGATTTGACTGGATTATTTTTTGGCTGGTGTGACATGTATTTAGGCG
prediction: (Category nonec1, tensor(1), tensor([0.0030, 0.9970]))
---------
sequence: ATGATTTAGCAACCATTTTAATCCCCCCTTCAAGTGGGGTTCAATCCGCTGAAGGAGCTCAGCTGGGAACAT
prediction: (Category nonec1, tensor(1), tensor([0.0132, 0.9868]))
---------
sequence: TGTCACTGGCAGCTTATTTAGTGTTCTCTTGTGCAGGACAGAAAGTTCCTGATAATCCAAAACTGGTAGTGATGATAGCCGGCGATATGTTC
prediction: (Category nonec1, tensor(1), tensor([0.0019, 0.9981]))
---------
sequence: TCTGCTGTGCCAGACCGATAAACGAATTCATGATACCAATGACGGTACCGAACAGACCGATATAGCGCGTTACTGAACCTACTGTGGCCAGAAAC
prediction: (Category nonec1, tensor(1), tensor([3.6912e-04, 9.9963e-01]))
---------
sequence: CATCATGGCCGGTTCCCAGCGTGCCATGCGCGTAGCCTATTCGCGTGAAGAGGAAAAGCTGGAAAAACATCTGCCGTTTCTGGCCACAGTAGGTTCAGTA
prediction: (Category ec1, tensor(0), tensor([0.7161, 0.2839]))
---------
sequence: TTATGGAGCATACCAAACATTACCAAATATACGAAAACAAAATTTTGCTATTTTGGTAGAAGGACAAACTGATTGTCTTCGTTTGGTAGAAAATGGTTT
prediction: (Category nonec1, tensor(1), tensor([0.0411, 0.9589]))
---------
sequence: TTTTTAAGCACAGTAGCGTGTTTGCTCGAAAATGCGGTTCCTGAGGTAGCAATTACATTAGAAAAACCATTTTCTACCAAACGAAGACAATCAGTTTGTC
prediction: (Category nonec1, tensor(1), tensor([0.2211, 0.7789]))
---------
sequence: CAGTGACAAGATAATTTTTTCATCGGTATGTTTTATTTATCACTATTTTTCTATCATAGTAATAGTTATCCACACCGCACTAGAACTGCTTTAAATGTT
prediction: (Category nonec1, tensor(1), tensor([0.0069, 0.9931]))
---------
sequence: TAGGTTGTACTTTGAGTCTGTAAGTGAATCGAAAGTGAATCAAAACGTGAACATTTAAAGCAGTTCTAGTGCGGTGTGGATAACTATTACTATGATAGAAA
prediction: (Category nonec1, tensor(1), tensor([0.0203, 0.9797]))
---------
sequence: GCCATGGGCGTTATTTGTCTAATTTGCCCTTTGATGCATCCACGAAGCGGGGTCATCCGTATCCCGGCATCGGTTCTTAACCAGCAAAGGAAGAACAAA
prediction: (Category ec1, tensor(0), tensor([0.6001, 0.3999]))
---------
sequence: AGCCAGCGTGCACCATCAAGGCGCTTTGCTATCGTATTTTCCGGGGCACCATCATTAATATCTCTCGTCTCTTTGTACTTCCTTTGCTGGTTAAGAACCGA
prediction: (Category nonec1, tensor(1), tensor([0.0165, 0.9835]))
---------
sequence: TCTTTTGCTTATTGTTGGTTCAACACAACGTGCACTTTCAGATGGTTCAAAAGTTAGAGGAGACATAAACGTTTTTCTTGTTGGAGATCCTGGTACGGC
prediction: (Category nonec1, tensor(1), tensor([0.2953, 0.7047]))
---------
sequence: CCTGATGTGTATAATCCTCTAGGAGCAATTCTTGAACAGAACTTTAACATTTCACTTTTTGCCGTACCAGGATCTCCAACAAGAAAAACGTTTATGTCTCC
prediction: (Category nonec1, tensor(1), tensor([0.4585, 0.5415]))
---------
sequence: TGCTTACATCAGTCATTTTTTTCACCAAATTCTTCGAGAATCTTAACTGGCCTTATCCGGTCTAAAGTCTT
prediction: (Category ec1, tensor(0), tensor([0.5849, 0.4151]))
---------
sequence: TGATTTCGGTAGCGGATATCCATCTGATAAAAAAACAATTAATTTTTTGAAGAGGTTCTATGCTGATAATGGAAAGTGGCCTGAGGG
prediction: (Category nonec1, tensor(1), tensor([0.1965, 0.8035]))
---------
sequence: AAAACTTTTCTAAAAAATCAATATCTACAATTAAAGAAGCAAGAATCCTAGATGGTGATTCCACATATTTTCTGAATTTTAATCATCAAGAAATTCAAA
prediction: (Category nonec1, tensor(1), tensor([0.1708, 0.8292]))
---------
sequence: AAAGNTTTTTTTTGATTAAATGGTTTGGAATTAAATATCCTAAATTTTCTTTTTGAATTTCTTGATGATTAAAATTCAGAAAATATGTGGAATCACCATCT
prediction: (Category nonec1, tensor(1), tensor([0.0047, 0.9953]))
---------
This model predicts whether a sequence comes from an oxidoreductase (EC 1.-.-.-) or not - 'ec1' or 'nonec1'. 3 out of 20 of the sequences are predicted as ec1, which is consistent with the results from the paper which found around 20% of sequences to be oxidoreductases in marine metagenomes.
Project details
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file fastBio-0.1.7.tar.gz.
File metadata
- Download URL: fastBio-0.1.7.tar.gz
- Upload date:
- Size: 40.6 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/3.3.0 pkginfo/1.7.1 requests/2.25.1 setuptools/52.0.0.post20210125 requests-toolbelt/0.9.1 tqdm/4.61.2 CPython/3.7.10
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
a1249b664a9c63026a77d14f45074aa03c08e867c736d92da0b11d914b2e8e08
|
|
| MD5 |
bcf3caae7c38c096022a9ec9e443d16e
|
|
| BLAKE2b-256 |
e446964d9bc2b79fe4fe273ad3c8bf3467c3f6ca465d114dbcaa79c76f507f86
|
File details
Details for the file fastBio-0.1.7-py3-none-any.whl.
File metadata
- Download URL: fastBio-0.1.7-py3-none-any.whl
- Upload date:
- Size: 27.4 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/3.3.0 pkginfo/1.7.1 requests/2.25.1 setuptools/52.0.0.post20210125 requests-toolbelt/0.9.1 tqdm/4.61.2 CPython/3.7.10
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
70d86ad9111c7d12e991c8a3cb23c854d09b9f152381efe4058a053f12d19e1b
|
|
| MD5 |
94beaec81f2683e3c3edac923568bea5
|
|
| BLAKE2b-256 |
7afc31f1622317b3171145445a9d58ec4a88eb1398a86e1787248c6661e0fcde
|