multiPrime 2.4.7

No project description provided

multiPrime

multiPrime (version=2.4.7) is an error-tolerant primer design tool for broad-spectrum pathogens detection. It proposes a solution for the maximal coverage degenerate primer design with error (MD-EDPD). pipeline links: https://github.com/joybio/multiPrime.

1. Install

pip

pip3 install multiPrime

• pip python >=3.9

2. Usage

$ multiPrime -h 

Parameters：

Parameters	Description
DPrime	Degenerate primer design through MD-EDPD or MD-DPD.
Ppair	Primer pair selection from the result of multiPrime DPrime.
Perfect	Extract primer-contained sequences with non-mismatches.
Errors	Extract primer-contained sequences with errors.

multiPrime DPrime -i input -o output
           Options: { -l [18] -n [4] -d [10] -v [1] -g [0.2,0.7] -f [0.8] -c [4] -p [10] -a [4] }

Parameters：

Parameters	Description
-i/--input	Input file: Result of multi-alignment. (muscle, mafft or others)
-l/--plen	Length of primer. Default: 18
-n/--dnum	Number of degenerate. Default: 4.
-v/--variation	Max mismatch number of primer. Default: 1.
-e/--entropy	Entropy is actually a measure of disorder. This parameter is used to judge whether the window is conservation. Entropy of primer-length window. Default: 3.6.
-g/--gc	Filter primers by GC content. Default [0.2,0.7].
-s/--size	Number of degenerate. Default: 4.
-f/--fraction	Filter primers by match fraction (Coverage with errors). Default: 0.8.
-c/--coordinate	Mismatch index is not allowed to locate in your specific positions. otherwise, it won't be regard as the mis-coverage. With this param, you can control the index of Y-distance (number=variation and position of mismatch). when calculate coverage with error. coordinate>0: 5'==>3'; coordinate<0: 3'==>5'. You can set this param to any value that you prefer. Default: 1,-1. 1: I dont want mismatch at the 2nd position, start from 0. -1: I dont want mismatch at the -1st position, start from -1.
-p/--proc	Number of process to launch. Default: 20.
-a/--away	Filter hairpin structure, which means distance of the minimal paired bases. Default: 4. Example:(number of X) AGCT[XXXX]AGCT. Primers should not have complementary sequences (no consecutive 4 bp complementarities),otherwise the primers themselves will fold into hairpin structure.
-o/--out	Output file: candidate primers. e.g. [*].candidate.primers.out.

multiPrime Ppair -i input -r reference -o output
           Options: {-f [0.6] -m [500] -n [200] -e [4] -p [9] -s [250,500] -g [0.4,0.6] -d [4] -a ","}

Parameters：

Parameters	Description
-i/--input	Input file: output of multiPrime DPrime.
-r/--ref	Reference sequence file: all the sequence in 1 fasta, for example: (Cluster_96_171.tfa).
-g/--gc	Filter primers by GC content. Default [0.2,0.7].
-f/--fraction	Filter primers by match fraction. Default: 0.6. Sometimes you need a small fraction to get output.
-e/--end	Filter primers by degenerate base position. e.g. [-e 4] means I dont want degenerate base appear at the end four bases when primer pre-filter. Default: 4.
-s/--size	Filter primers by PRODUCT size. Default [250,500].
-d/--dist	Filter param of hairpin, which means distance of the minimal paired bases. Default: 4. Example:(number of X) AGCT[XXXX]AGCT.
-t/--tm	Difference of Tm between primer-F and primer-R. Default: 5.
-p/--proc	Number of process to launch. Default: 20.
-a/--adaptor	Adaptor sequence, which is used for NGS next. Hairpin or dimer detection for [adaptor--primer]. example: TCTTTCCCTACACGACGCTCTTCCGATCT,TCTTTCCCTACACGACGCTCTTCCGATCT (Default). If you dont want adaptor, use [","]
-m/--maxseq	Limit of sequence number. Default: 0. If 0, then all sequence will take into account. This param should consistent with [max_seq] in multi-alignment.
-o/--out	Output file: candidate primer pairs. e.g. [*].candidate.primers.txt.

multiPrime Perfect -i [input] -p [10] -f [format] -o [output] -s [Coverage.xls]

Parameters：

Parameters	Description
-i/--input	Input file: Primer file. One of the followed three types: final_maxprimers_set.xls (see output of multiPrime in github (https://github.com/joybio/multiPrime)); primer.fa (primer fasta) or primer_F,primer_R.
-r/--ref	Sequence file: all the input sequences in 1 fasta.
-f/--format	Format of primer file: xls or fa or seq; default: xls, indicate final_maxprimers_set.xls. xls: final_primer_set.xls; fa:fasta format or seq: sequence format, comma seperate. e.g. primer_F,Primer_R.
-p/--process	Number of process to launch. Default: 20.
-o/--out	Output_dir. default: PCR_product.
-s/--stast	Stast information: number of coverage and total. Default: Coverage.xls.

multiPrime Errors -i [input] -r [bowtie index] -l [150,2000] -p [10]-o [output]

Parameters：

Parameters	Description
-i/--input	input file: primer.fa.
-r/--ref	reference file: the fasta of raw input.
-l/--len	Length of primer, which is used for mapping. If the length of the primer used for mapping is set to 0, the entire length of the primer will be utilized. Default: 0
-d/--dict	It is used to extract non-coverd sequences and can be obtained from prepare_fa_pickle.py (https://github.com/joybio/multiPrime). Dictionary of targets sequences, binary format. Default: None
-t/--term	Position of mismatch is not allowed in the 3 term of primer. Default: 4
-b/--bowtie	bowtie/ABS_path(bowtie) or bowtie2/ABS_path(bowtie2) was employed for mapping. Default: bowtie2
-m/--seedmms	Bowtie: Mismatches in seed (can be 0 - 3, default: -n 1).Bowtie2: Gap or mismatches in seed (can be 0 - 1, default: -n 1).
-p/--process	Number of process to launch. Default: 20.
-o/--out	Output file: PCR product with primers.

3. Results

multiPrime DPrime

• output：Information of primer.
• output.gap_seq_id_json: Positions and non-contained sequences caused by errors (number of errors are greater than threshold).
• output.non_coverage_seq_id_json: Positions and non-contained sequences.

multiPrime Ppair

• output：*.candidate.primers.txt

multiPrime Perfect

• output：PCR_product
• Coverage.xls：Total coverage for all primers.

multiPrime Errors

• output：PCR product with primer pairs.
• output.pair.num：Target amplicon number with primer pairs.
• others：Temp files.
• unmatched.fa: the sequences that were not captured by the core primer set with setting mismatches.

4. test dir

multiPrime/example

5. Contact

Please send comments, suggestions, bug reports and bug fixes to [e-mail]