multiPrime 2.3.5

No project description provided

multiPrime

multiPrime is an error-tolerant primer design tool for broad-spectrum pathogens detection. It proposes a solution for the minimum degeneracy degenerate primer design with error (MD-EDPD).

1. Install

pip

pip3 install multiPrime

• pip python >=3.9

2. Usage

$ multiPrime -h 

Parameters：

Parameters	Description
DPrime	Degenerate primer design through MD-EDPD or MD-DPD.
Ppair	Primer pair selection from the result of multiPrime DPrime.
Perfect	Extract primer-contained sequences with non-mismatches.
Errors	Extract primer-contained sequences with errors.

multiPrime DPrime -i input -o output
           Options: { -l [18] -n [4] -d [10] -v [1] -g [0.2,0.7] -f [0.8] -c [4] -p [10] -a [4] }

Parameters：

Parameters	Description
-i/--input	Input file: Result of multi-alignment. (muscle, mafft or others)
-l/--plen	Length of primer. Default: 18
-n/--dnum	Number of degenerate. Default: 4.
-v/--variation	Max mismatch number of primer. Default: 1.
-e/--entropy	Entropy is actually a measure of disorder. This parameter is used to judge whether the window is conservation. Entropy of primer-length window. Default: 3.6.
-g/--gc	Filter primers by GC content. Default [0.2,0.7].
-s/--size	Number of degenerate. Default: 4.
-f/--fraction	Filter primers by match fraction (Coverage with errors). Default: 0.8.
-c/--coordinate	Mismatch index is not allowed to locate in start or stop. otherwise, it won't be regard as the mis-coverage. With this param, you can control the index of Y-distance (number=variation and position of mismatch) when calculate coverage with error.Default: 4.
-p/--proc	Number of process to launch. Default: 20.
-a/--away	Filter hairpin structure, which means distance of the minimal paired bases. Default: 4. Example:(number of X) AGCT[XXXX]AGCT. Primers should not have complementary sequences (no consecutive 4 bp complementarities),otherwise the primers themselves will fold into hairpin structure.
-o/--out	Output file: candidate primers. e.g. [*].candidate.primers.out.

multiPrime Ppair -i input -r reference -o output
           Options: {-f [0.6] -m [500] -n [200] -e [4] -p [9] -s [250,500] -g [0.4,0.6] -d [4] -a ","}

Parameters：

Parameters	Description
-i/--input	Input file: output of multiPrime DPrime.
-r/--ref	Reference sequence file: all the sequence in 1 fasta, for example: (Cluster_96_171.tfa).
-g/--gc	Filter primers by GC content. Default [0.2,0.7].
-f/--fraction	Filter primers by match fraction. Default: 0.6. Sometimes you need a small fraction to get output.
-e/--end	Filter primers by degenerate base position. e.g. [-e 4] means I dont want degenerate base appear at the end four bases when primer pre-filter. Default: 4.
-s/--size	Filter primers by PRODUCT size. Default [250,500].
-d/--dist	Filter param of hairpin, which means distance of the minimal paired bases. Default: 4. Example:(number of X) AGCT[XXXX]AGCT.
-t/--tm	Difference of Tm between primer-F and primer-R. Default: 5.
-p/--proc	Number of process to launch. Default: 20.
-a/--adaptor	Adaptor sequence, which is used for NGS next. Hairpin or dimer detection for [adaptor--primer]. example: TCTTTCCCTACACGACGCTCTTCCGATCT,TCTTTCCCTACACGACGCTCTTCCGATCT (Default). If you dont want adaptor, use [","]
-m/--maxseq	Limit of sequence number. Default: 0. If 0, then all sequence will take into account. This param should consistent with [max_seq] in multi-alignment.
-o/--out	Output file: candidate primer pairs. e.g. [*].candidate.primers.txt.

multiPrime Perfect -i [input] -p [10] -f [format] -o [output] -s [Coverage.xls]

Parameters：

Parameters	Description
-i/--input	Input file: Primer file. One of the followed three types: final_maxprimers_set.xls (see output of multiPrime in github (https://github.com/joybio/multiPrime)); primer.fa (primer fasta) or primer_F,primer_R.
-r/--ref	Sequence file: all the input sequences in 1 fasta.
-f/--format	Format of primer file: xls or fa or seq; default: xls, indicate final_maxprimers_set.xls. xls: final_primer_set.xls; fa:fasta format or seq: sequence format, comma seperate. e.g. primer_F,Primer_R.
-p/--process	Number of process to launch. Default: 20.
-o/--out	Output_dir. default: PCR_product.
-s/--stast	Stast information: number of coverage and total. Default: Coverage.xls.

multiPrime Errors -i [input] -r [bowtie index] -l [150,2000] -p [10]-o [output]

Parameters：

Parameters	Description
-i/--input	input file: primer.fa.
-r/--ref	reference file: bowtie index.
-l/--len	Length of primer, which is used for mapping. Default: 18
-t/--term	Position of mismatch is not allowed in the 3 term of primer. Default: 4
-b/--bowtie	bowtie or bowtie2 was employed for mapping. Default: bowtie2
-m/--seedmms	Bowtie: Mismatches in seed (can be 0 - 3, default: -n 1).Bowtie2: Gap or mismatches in seed (can be 0 - 1, default: -n 1).
-p/--process	Number of process to launch. Default: 20.
-o/--out	Output file: PCR product with primers.

3. Results

multiPrime DPrime

• output：Information of primer.
• output.gap_seq_id_json: Positions and non-contained sequences caused by errors (number of errors are greater than threshold).
• output.non_coverage_seq_id_json: Positions and non-contained sequences.

multiPrime Ppair

• output：*.candidate.primers.txt

multiPrime Perfect

• output：PCR_product
• Coverage.xls：Total coverage for all primers.

multiPrime Errors

• output：PCR product with primer pairs.
• output.pair.num：Target amplicon number with primer pairs.
• others：Temp files.

4. test dir

multiPrime/example

5. Contact

Please send comments, suggestions, bug reports and bug fixes to [e-mail]