plannotate-python 1.2.9

Automated annotation of engineered plasmids using sequence similarity searches

pLannotate-python

Automated annotation of engineered plasmids

pLannotate-python is a Python package for automatically annotating engineered plasmids using sequence similarity searches against curated databases. Fast, parallel processing with automatic database setup. All it is, is a python friendly wrapper around CLI tools. This means the CLI tools (and the databases they rely on) are required to be set up first.

Features

• Fast, parallel annotation: Uses Diamond, BLAST, and Infernal concurrently
• Multiple databases: Protein (fpbase, swissprot), nucleotide (snapgene), RNA (Rfam)
• Circular plasmid support: Handles origin-crossing features
• Automatic database setup: Downloads and configures databases (~900MB)
• Flexible output: GenBank files, CSV reports, or pandas DataFrames

Installation

# Install with uv (recommended)
uv add plannotate-python

# Or with pip
pip install plannotate-python

External Tools Required

# macOS (Homebrew)
brew install diamond blast infernal ripgrep

# Linux (conda/mamba)
conda install -c bioconda diamond blast infernal ripgrep

# Ubuntu/Debian
sudo apt install diamond-aligner ncbi-blast+ infernal ripgrep

SSL Certificate Fix (macOS)

If you encounter SSL certificate errors during database download:

# Replace X.Y with your Python version (e.g., 3.11)
open "/Applications/Python X.Y/Install Certificates.command"

"Quick" Start

Automatic Database Setup:

import os
os.environ["PLANNOTATE_AUTO_DOWNLOAD"] = "1"  # Enable auto-download of databases
from plannotate.annotate import annotate

# First run will download databases (~900MB with progress bars)
>>> sequence="tgaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataggtctcaatccacgggtacgggtatggagaaacagtagagagttgcgataaaaagcgtcaggtagtatccgctaatcttatggataaaaatgctatggcatagcaaagtgtgacgccgtgcaaataatcaatgtggacttttctgccgtgattatagacacttttgttacgcgtttttgtcatggctttggtcccgctttgttacagaatgcttttaataagcggggttaccggtttggttagcgagaagagccagtaaaagacgcagtgacggcaatgtctgatgcaatatggacaattggtttcttgtaatcgttaatccgcaaataacgtaaaaacccgcttcggcgggtttttttatggggggagtttagggaaagagcatttgtcatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcgg"  # Your plasmid sequence
>>> result = annotate(sequence, linear=False)  # False for circular plasmids

>>> result
   qstart  qend              sseqid   pident  slen                                               qseq  length  ...  wiggle  wstart  wend  kind  qstart_dup qend_dup fragment
0     523   615   AmpR_promoter_(5)  100.000    92  TTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAG...      92  ...      13     536   601     1         523      614    False
1      11    83  rrnB_T1_terminator  100.000    72  CAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTA...      72  ...      10      21    72     1          11       82    False
2     155   440     araBAD_promoter   99.649   285  ATGGAGAAACAGTAGAGAGTTGCGATAAAAAGCGTCAGGTAGTATC...     285  ...      42     197   397     1         816     1100    False
3      98   126     T7Te_terminator  100.000    28                       GGCTCACCTTCGGGTGGGCCTTTCTGCG      28  ...       4     102   121     1          98      125    False
4     615   661                AmpR  100.000   861     ATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGG      46  ...       6     621   654     1         615      660     True

[5 rows x 28 columns]

Manual Database Setup:

from plannotate.resources import download_db
download_db()  # Downloads with progress bars and SSL error handling

Generate GenBank Files:

from plannotate.resources import get_gbk
gbk_content = get_gbk(result, sequence, is_linear=False)
with open("my_plasmid.gbk", "w") as f:
    f.write(gbk_content)

Configuration

Environment Variables:

• PLANNOTATE_AUTO_DOWNLOAD=1 - Auto-download databases without prompting
• PLANNOTATE_DB_DIR=/path - Custom database directory
• PLANNOTATE_SKIP_DB_DOWNLOAD=1 - Skip database downloads entirely

Core Functions:

• annotate(sequence, linear=False) - Annotate DNA sequence
• get_gbk(annotations, sequence) - Generate GenBank file
• download_db() - Download databases with progress bars

Troubleshooting

SSL Certificate Errors: Run the SSL certificate fix command above Empty Results: Sequence may not match database features
Tool Errors: Ensure external tools are installed and in PATH

Citation

If you use pLannotate-python in your research, please cite the original pLannotate paper:

McGuffin, M.J., Thiel, M.C., Pineda, D.L. et al. pLannotate: automated annotation of engineered plasmids. Nucleic Acids Research (2021).

License

This project is licensed under the GPL v3 License - see the LICENSE file for details.

Links

• Original pLannotate: https://github.com/mmcguffi/pLannotate
• Web server: http://plannotate.barricklab.org/
• This Fork: https://github.com/McClain-Thiel/pLannotate
• Issues: https://github.com/McClain-Thiel/pLannotate/issues