Automated annotation of engineered plasmids using sequence similarity searches
This project has been archived.
The maintainers of this project have marked this project as archived. No new releases are expected.
Project description
pLannotate-python
Automated annotation of engineered plasmids
pLannotate-python is a Python package for automatically annotating engineered plasmids using sequence similarity searches against curated databases. This is a streamlined, installable version of the original pLannotate tool, designed for programmatic use and integration into bioinformatics workflows. It has been optimized for performance with parallel processing.
Features
- Fast, parallel annotation: Uses local installations of Diamond, BLAST, and Infernal to run comprehensive sequence searches concurrently.
- Multiple databases: Search against protein (fpbase, swissprot), nucleotide (snapgene), and RNA (Rfam) databases.
- Circular plasmid support: Handles origin-crossing features in circular plasmids.
- Flexible output: Generate GenBank files, CSV reports, or work with pandas DataFrames.
- Batch processing: Annotate multiple plasmids programmatically with high performance.
Installation
1. Install pLannotate-python
# Install from PyPI
pip install plannotate-python
# Or install from source
git clone https://github.com/McClain-Thiel/pLannotate.git
cd pLannotate
pip install -e .
# Or install with uv (recommended)
uv add plannotate-python
2. Install External Tools
pLannotate-python requires external bioinformatics tools for sequence searching.
Required:
- BLAST+: For nucleotide searches.
- DIAMOND: For fast protein searches.
- Infernal: For RNA secondary structure searches.
- ripgrep (
rg): For fast searches in compressed database files.
On macOS (using Homebrew)
# Install Homebrew if not already installed
/bin/bash -c "$(curl -fsSL https://raw.githubusercontent.com/Homebrew/install/HEAD/install.sh)"
# Install bioinformatics tools
brew install diamond blast infernal ripgrep
On Linux (using Conda/Mamba)
# Install conda/mamba if not already installed
# Then install bioinformatics tools
conda install -c bioconda diamond blast infernal ripgrep
# Or with mamba (faster)
mamba install -c bioconda diamond blast infernal ripgrep
On Linux (using package managers)
Ubuntu/Debian:
sudo apt update
sudo apt install diamond-aligner ncbi-blast+ infernal ripgrep
CentOS/RHEL/Fedora:
# Install EPEL repository first
sudo yum install epel-release
sudo yum install diamond ncbi-blast+ infernal ripgrep
3. Verify Installation
# Check that tools are installed
diamond --version
blastn -version
cmscan -h
rg --version
# Test pLannotate import
python -c "from plannotate.annotate import annotate; print('✓ pLannotate-python installed successfully')"
Setting up the data
This whole repo requires data.
Quick Start
Basic Usage
from plannotate.annotate import annotate
# Annotate a plasmid sequence
sequence = "ATGGTGAGCAAGGGCGAGGAGCTG" # Your plasmid sequence
result = annotate(sequence, linear=False) # False for circular plasmids
# View results
print(f"Found {len(result)} annotations")
print(result[['Feature', 'Type', 'qstart', 'qend', 'pident']].head())
Generate GenBank File
from plannotate.annotate import annotate
from plannotate.resources import get_gbk
# Annotate sequence
sequence = "ATGGTGAGCAAGGGCGAGGAGCTG..."
annotations = annotate(sequence, linear=False)
# Generate GenBank file
gbk_content = get_gbk(annotations, sequence, is_linear=False)
# Save to file
with open("my_plasmid.gbk", "w") as f:
f.write(gbk_content)
Database Setup
For full functionality, you need to set up local sequence databases.
1. Download/Create Databases
Protein Databases (Diamond format):
- fpbase: Fluorescent proteins database
- swissprot: SwissProt protein database
Nucleotide Databases (BLAST format):
- snapgene: Common cloning features
RNA Databases (Infernal format):
- Rfam: RNA families database
2. Example Database Setup
# Create database directory
mkdir -p databases
# Example: Create fpbase diamond database
# (You need to obtain the fpbase protein sequences in a FASTA file)
diamond makedb --in fpbase.fasta --db databases/fpbase
# Example: Create BLAST nucleotide database
makeblastdb -in snapgene.fasta -dbtype nucl -out databases/snapgene
# Example: Download and prepare Rfam (large download ~2GB)
wget ftp://ftp.ebi.ac.uk/pub/databases/Rfam/CURRENT/Rfam.cm.gz
gunzip Rfam.cm.gz
mv Rfam.cm databases/
3. Update Database Configuration
Edit plannotate/data/data/databases.yml to point to your local database files. Note: You must provide the full path to the database files.
fpbase:
method: diamond
location: /path/to/your/databases/fpbase.dmnd
priority: 1
# ... other settings
snapgene:
method: blastn
location: /path/to/your/databases/snapgene
priority: 1
# ... other settings
Rfam:
method: infernal
location: /path/to/your/databases/Rfam.cm
priority: 3
# ... other settings
API Reference
Core Functions
annotate(sequence, yaml_file=None, linear=False, is_detailed=False)
Annotate a DNA sequence by running searches against multiple databases in parallel.
Parameters:
sequence(str): DNA sequence to annotate.yaml_file(str, optional): Path to a custom database configuration file. Defaults to the internaldatabases.yml.linear(bool):Truefor linear DNA,Falsefor circular plasmids.is_detailed(bool): Include detailed feature information.
Returns:
pandas.DataFrame: A DataFrame containing the annotation results.
get_gbk(annotations_df, sequence, is_linear=False, record=None)
Generate GenBank format output from an annotations DataFrame.
Parameters:
annotations_df(DataFrame): Annotation results fromannotate().sequence(str): Original DNA sequence.is_linear(bool):Truefor linear DNA,Falsefor circular.record(SeqRecord, optional): An existing Biopython SeqRecord to annotate.
Returns:
str: GenBank formatted text.
Troubleshooting
Common Issues
"Tool not found in PATH"
# Ensure tools are installed and accessible in your shell's PATH
which diamond blastn cmscan rg
# If using conda, make sure your environment is activated
conda activate your_environment
"No such file or directory" for databases
- Verify that the database paths in
databases.ymlare correct and are absolute paths. - Ensure the database files exist and have the correct read permissions.
- Check that Diamond databases have a
.dmndextension if you've specified one in the config.
Empty results
- The input sequence may not have any matches in the configured databases.
- Try lowering the identity thresholds or other search parameters in
databases.yml. - Verify that your databases are correctly formatted and contain relevant sequences for your plasmids.
Performance
The annotation process is parallelized and will use multiple CPU cores to speed up the database searches. Performance will depend on the size of your databases and the number of available cores.
Citation
If you use pLannotate-python in your research, please cite the original pLannotate paper:
McGuffin, M.J., Thiel, M.C., Pineda, D.L. et al. pLannotate: automated annotation of engineered plasmids. Nucleic Acids Research (2021).
License
This project is licensed under the GPL v3 License - see the LICENSE file for details.
Links
- Original pLannotate: https://github.com/mmcguffi/pLannotate
- Web server: http://plannotate.barricklab.org/
- This Fork: https://github.com/McClain-Thiel/pLannotate
- Issues: https://github.com/McClain-Thiel/pLannotate/issues
Project details
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file plannotate_python-1.2.6.tar.gz.
File metadata
- Download URL: plannotate_python-1.2.6.tar.gz
- Upload date:
- Size: 27.3 MB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.2.0 CPython/3.9.8
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
f5e3ec172194f34918b3cf2066a916e5b4db83092f8c8c320e2f44f07c3e3a93
|
|
| MD5 |
7bba051a4de747bc706ad1a459ae27ef
|
|
| BLAKE2b-256 |
a6c80782f0b6c16cd1c15254dcc737785645c41a201d5c4528d3e3ad9596469d
|
File details
Details for the file plannotate_python-1.2.6-py3-none-any.whl.
File metadata
- Download URL: plannotate_python-1.2.6-py3-none-any.whl
- Upload date:
- Size: 27.2 MB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.2.0 CPython/3.9.8
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
e51c49902a24910ea3f231789394015676144270ef7403f10c83e12ea387a7f7
|
|
| MD5 |
eb65c4c8ad34d13bb20f0209f3eb66e1
|
|
| BLAKE2b-256 |
b7f6814fcc97fdf77b13ab6ee9b5bde6a74892fd10667e2343dae3d059da644b
|