primer3-py 0.3.1

Python bindings for Primer3

primer3-py is a collection of Python bindings for a derivative of the popular Primer3 version 2.3.6 C library. The package provides a simple API for low-level thermodynamic calculations pertinent to oligonucleotide design (e.g., melting temperature) as well as a simple interface to the Primer3 design engine for a more holistic approach to primer design. All of the bindings are implemented using the Python C API, which means that they are highly efficient but do require initial compilation (see Installation, below).

We do not provide any additional abstraction of the Primer3 design engine, so we suggest that you refer to the official Primer3 documentation for assistance.

Installation

primer3-py has no external library dependencies and should compile on most linux and OS X systems that are running Python 2.7, 3.3, or 3.4.

To build primer3-py within the package directory run:

$ python setup.py build_ext --inplace

If you would like to install primer3-py in your local Python environment you may do so using either pip or the setup.py script:

$ pip install primer3-py
          or
$ python setup.py install

Testing

We have included a comprehensive test suite to compare the output of the Python bindings with the output of the Primer3 binaries. After building and (optionally) installing primer3-py you can run the tests using the primer3_tests.py module:

$ python primer3_tests.py

or for memory checking with valgrind:

$ valgrind --tool=memcheck --suppressions=valgrind-python.supp --leak-check=full python primer3_test.py

API - low-level thermodynamics

primer3-py includes a unified API for low-level thermodynamic calculations that are useful for routine oligonucleotide design.

The simplest API function is calcTm, which uses nearest-neighbor thermodynamics to calculate the melting temperature of a provided DNA sequence:

>>> import primer3
>>> primer3.calcTm('ATTTGGGACCAATTTGGACCAGGTT')
57.02235387653167

Higher-level thermodynamic functions include calcHairpin, calcHomodimer, and calcHeterodimer. These functions perform a thermodynamic alignment to determine the characteristics (dH, dS, dG, Tm) of a secondary / multi-stranded structure. All three functions return a namedtuple:

>>> from primer3 import calcHeterodimer
>>> res = calcHeterodimer('CCGACCCTATGGGACC', 'TTGGTCCCATAAGGGTCGG')
>>> print(res)

thermoresult(
  structure_found=True,
  tm=39.92795428766294,
  ds=-370.12644214999796,
  dh=-127200.0,
  dg=-12405.28396717814,
  align_end_1=16,
  align_end_2=17
)

>>> print res.tm
39.92795428766294

For more detailed documentation and usage examples, see primer3/bindings.py and primer3_test.py.

API - primer design

primer3-py also includes C API bindings for the Primer3 design engine. As mentioned above, we do not provide any additional “Pythonic” abstraction of the original design process (that’s up to you!) so the general interface is basically Boulder IO input/output in the form of Python dictionaries.

There are few deviations from the formats described in the Primer3 documentation, with notable exceptions being related to index lists and ranges (i.e., ranges are typically provided as lists/tuples, and lists of ranges as lists of lists or tuples of tuples). Here we highlight the differences between the typical SEQUENCE_PRIMER_PAIR_OK_REGION_LIST input and the Python binding input:

Primer3 boulder IO input:   100,50,300,50 ; 900,60,,
Primer3 python input:       [[100,50,300,50], [900,60,-1,-1]]

Similarly, PRIMER_PRODUCT_SIZE_RANGE is provided in the following forms:

Primer3 boulder IO input:   75-100 100-125 125-150
Primer3 python input:       [[75,100],[100,125],[125,150]]

For more detailed documentation and usage examples, see primer3/bindings.py and primer3_test.py.

Contact and contributions

We are very grateful for any bug fixes or suggestions that you may have. If you would like to report an issue or idea, or if you would like to contribute to the project, please visit the project’s Github page (http://github.com/benpruitt/primer3-py)

Licensing and citations

Citations should reference the lastest Primer3 paper:

Untergasser, Andreas, et al. "Primer3—new capabilities and interfaces."
Nucleic acids research 40.15 (2012): e115-e115.
doi: 10.1093/nar/gks596

All project code, including the derivative Primer3 library, is licensed under GPLv2. The included Python and Python C API bindings are Copyright (c) 2014 Ben Pruitt, Nick Conway; Wyss Institute for Biologically Inspired Engineering.