Skip to main content

An easy-to-use Python API for Primer3 primer design.

Project description

Primer3Plus

PyPI version

Primer3Plus is a Python DNA primer design tool based off of Primer3 and the Python primer3 wrapper (https://pypi.org/project/primer3-py/).

import json

design = Design()
template = """
TCATGTAATTAGTTATGTCACGCTTACATTCACGCCCTCCCCCCAC
ATCCGCTCTAACCGAAAAGGAAGGAGTTAGACAACCTGAAGTCTAG
GTCCCTATTTATTTTTTTATAGTTATGTTAGTATTAAGAACGTTAT
TTATATTTCAAATTTTTCTTTTTTTTCTGTACAGACGCGTGTACGC
ATGTAACATTATACTGAAAACCTTGCTTGAGAAGGTTTTGGGACGC
TCGAAGGCTTTAATTTGC
"""
template = template.replace('\n', '').replace(' ', '')
design.settings.template(template)
design.settings.as_cloning_task()
design.settings.primer_num_return(1)
results, explain = design.run()

print(json.dumps(results, indent=1))
print(json.dumps(explain, indent=1))
{
 "0": {
  "PAIR": {
   "PENALTY": 11.204301707622733,
   "COMPL_ANY_TH": 0.0,
   "COMPL_END_TH": 0.0,
   "PRODUCT_SIZE": 248
  },
  "LEFT": {
   "PENALTY": 9.027129166714644,
   "SEQUENCE": "TCATGTAATTAGTTATGTCACGCTTAC",
   "location": [
    0,
    27
   ],
   "TM": 57.972870833285356,
   "GC_PERCENT": 33.333333333333336,
   "SELF_ANY_TH": 0.0,
   "SELF_END_TH": 0.0,
   "HAIRPIN_TH": 0.0,
   "END_STABILITY": 2.34
  },
  "RIGHT": {
   "PENALTY": 2.1771725409080886,
   "SEQUENCE": "GCAAATTAAAGCCTTCGAGCG",
   "location": [
    247,
    21
   ],
   "TM": 58.82282745909191,
   "GC_PERCENT": 47.61904761904762,
   "SELF_ANY_TH": 0.0,
   "SELF_END_TH": 0.0,
   "HAIRPIN_TH": 38.006257959698985,
   "END_STABILITY": 5.03
  }
 }
}
{
 "PRIMER_LEFT_EXPLAIN": "considered 10, low tm 9, ok 1",
 "PRIMER_RIGHT_EXPLAIN": "considered 10, low tm 3, high tm 4, ok 3",
 "PRIMER_PAIR_EXPLAIN": "considered 1, ok 1",
 "PRIMER_LEFT_NUM_RETURNED": 1,
 "PRIMER_RIGHT_NUM_RETURNED": 1,
 "PRIMER_INTERNAL_NUM_RETURNED": 0,
 "PRIMER_PAIR_NUM_RETURNED": 1
}

Installation

pip install primer3plus -U

Requirements

python >= 3.5

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Files for primer3plus, version 1.0.8
Filename, size File type Python version Upload date Hashes
Filename, size primer3plus-1.0.8-py3-none-any.whl (48.3 kB) File type Wheel Python version py3 Upload date Hashes View
Filename, size primer3plus-1.0.8.tar.gz (46.3 kB) File type Source Python version None Upload date Hashes View

Supported by

Pingdom Pingdom Monitoring Google Google Object Storage and Download Analytics Sentry Sentry Error logging AWS AWS Cloud computing DataDog DataDog Monitoring Fastly Fastly CDN DigiCert DigiCert EV certificate StatusPage StatusPage Status page