pybwa
Python bindings for bwa, the Burrows-Wheeler Aligner.
Pybwa provides native Python access to bwa's indexing and alignment algorithms, returning
pysam AlignedSegment objects for downstream analysis.
Visit us at Fulcrum Genomics to learn more about how we can power your Bioinformatics with pybwa and beyond.
Quick Start
Align reads with bwa mem
bwa mem is the recommended algorithm for reads longer than ~70bp (Illumina, etc.).
from pybwa import BwaMem
mem = BwaMem(prefix="/path/to/genome.fasta")
for recs in mem.align(queries=["CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA"]):
for rec in recs:
print(rec)
Align short reads with bwa aln
bwa aln is designed for short reads (<100bp, e.g. Illumina).
from pybwa import BwaAln
aln = BwaAln(prefix="/path/to/genome.fasta")
for rec in aln.align(queries=["GATTACA"]):
print(rec)
Reuse an index across aligners
Load a BwaIndex once and pass it to multiple aligners to avoid reloading:
from pybwa import BwaIndex, BwaAln, BwaMem
index = BwaIndex(prefix="/path/to/genome.fasta")
aln = BwaAln(index=index)
mem = BwaMem(index=index)
Installation
Install with pip install pybwa or conda install -c bioconda pybwa.
Requires Python 3.10+
Documentation
See the full documentation on pybwa.readthedocs.org.
Visit us at Fulcrum Genomics to learn more about how we can power your Bioinformatics with pybwa and beyond.
1 maintainer
Metadata
1 maintainer
Release files for pybwa 2.3.2
For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.
Source distribution (sdist)
| File | Size | Uploaded | Provenance | Actions |
|---|---|---|---|---|
| pybwa-2.3.2.tar.gz | 7.9 MB | With provenance | Details for pybwa-2.3.2.tar.gz |
Built distributions (wheels)
Total release size: 296.5 MB
Release files / pybwa-2.3.2.tar.gz
| Download URL | pybwa-2.3.2.tar.gz |
|---|---|
| Size | 7.9 MB |
| Tags | Source |
|
SHA-256 checksum How to use checksums |
b2a25b358f1f8fa069cd8a4d15ab730497b90095645a59d6f9a03b56261afae9
|
|
BLAKE2b-256 checksum How to use checksums |
1d68d185225ca151d487b89873e93d27afb071e4668841c181611fc981bb89d4
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp314-cp314-musllinux_1_2_x86_64.whl
| Download URL | pybwa-2.3.2-cp314-cp314-musllinux_1_2_x86_64.whl |
|---|---|
| Size | 13.2 MB |
| Tags | CPython 3.14 Linux musl 1.2+ x86-64 |
|
SHA-256 checksum How to use checksums |
e4fc8ff428d2845ca1409e3e7003f8995add8f0f876742b503f7832d379fe0fe
|
|
BLAKE2b-256 checksum How to use checksums |
52a12f46ba3f0b9c0131f81536a137cb7eb531cfd0d4c45aada3c48970753e19
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp314-cp314-musllinux_1_2_aarch64.whl
| Download URL | pybwa-2.3.2-cp314-cp314-musllinux_1_2_aarch64.whl |
|---|---|
| Size | 12.9 MB |
| Tags | CPython 3.14 Linux musl 1.2+ ARM64 |
|
SHA-256 checksum How to use checksums |
451d7c29e066e6aeffc6328b53ec9feb0cd3af826379259746e69e68abed69ef
|
|
BLAKE2b-256 checksum How to use checksums |
8f367dc48982d93cd66cb5c6f36feb307ec74ef19f6baaf503be48a9cff3d1bf
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp314-cp314-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl
| Download URL | pybwa-2.3.2-cp314-cp314-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 13.4 MB |
| Tags | CPython 3.14 Linux glibc 2.27+ x86-64 Linux glibc 2.28+ x86-64 |
|
SHA-256 checksum How to use checksums |
14e3a18d7a2a4d226e6a778c85ff946e96602ffc8b5f9b726e5b655f664b32e7
|
|
BLAKE2b-256 checksum How to use checksums |
e397cf56cc945eb17896faf91f173b2c51cb4155e9732408a644e927e9e1dd73
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp314-cp314-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl
| Download URL | pybwa-2.3.2-cp314-cp314-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl |
|---|---|
| Size | 12.7 MB |
| Tags | CPython 3.14 Linux glibc 2.27+ ARM64 Linux glibc 2.28+ ARM64 |
|
SHA-256 checksum How to use checksums |
2dee400273719f3532b614e9fbc11aef8b826dc0c78343cff97eb61ed11840b5
|
|
BLAKE2b-256 checksum How to use checksums |
0b9a62f40267e86c720945e60e81b5ffeac45f846f6a7354cca814b584320516
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp313-cp313-musllinux_1_2_x86_64.whl
| Download URL | pybwa-2.3.2-cp313-cp313-musllinux_1_2_x86_64.whl |
|---|---|
| Size | 13.2 MB |
| Tags | CPython 3.13 Linux musl 1.2+ x86-64 |
|
SHA-256 checksum How to use checksums |
d67ff84eeefb9773e987bd061d91b60143205b897c63aa6a58e83eb3118aaee0
|
|
BLAKE2b-256 checksum How to use checksums |
e449350cb14d14721b1e5cf5f82f2e3c5c98278e80e4a82fbeeab10f7cffaead
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp313-cp313-musllinux_1_2_aarch64.whl
| Download URL | pybwa-2.3.2-cp313-cp313-musllinux_1_2_aarch64.whl |
|---|---|
| Size | 12.9 MB |
| Tags | CPython 3.13 Linux musl 1.2+ ARM64 |
|
SHA-256 checksum How to use checksums |
f5800da3eae1ef47abae4fe10c4276c257cdaa24dc79a454de0f4ff2cb44266c
|
|
BLAKE2b-256 checksum How to use checksums |
d9a6becdea23b3c63656ed61d6b555a1bd3b1969ac3959149ca8f42f400e638e
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp313-cp313-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl
| Download URL | pybwa-2.3.2-cp313-cp313-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 13.4 MB |
| Tags | CPython 3.13 Linux glibc 2.27+ x86-64 Linux glibc 2.28+ x86-64 |
|
SHA-256 checksum How to use checksums |
87f42450cb4c6751d170b6849f1e1b54adff60419e60ec043244f0218e3a36b4
|
|
BLAKE2b-256 checksum How to use checksums |
0b52bda1ec238e397e28cce6c7ca91af45c5d6c9034936f953c19a5deb830e52
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp313-cp313-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl
| Download URL | pybwa-2.3.2-cp313-cp313-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl |
|---|---|
| Size | 12.7 MB |
| Tags | CPython 3.13 Linux glibc 2.27+ ARM64 Linux glibc 2.28+ ARM64 |
|
SHA-256 checksum How to use checksums |
f8123268e826e799fb9b79c268cad615344d3d7361c894b032ea797542f8afdb
|
|
BLAKE2b-256 checksum How to use checksums |
f13c8d470b33ba897a4d2cd3713252a4c5e139cd271d5381a453b2b388d0b46d
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp313-cp313-macosx_11_0_arm64.whl
| Download URL | pybwa-2.3.2-cp313-cp313-macosx_11_0_arm64.whl |
|---|---|
| Size | 3.4 MB |
| Tags | CPython 3.13 macOS 11.0+ ARM64 |
|
SHA-256 checksum How to use checksums |
30cec4ccfbf99f87feed8425e872e237c40824e6d4f1dcd967401a6c02326a6d
|
|
BLAKE2b-256 checksum How to use checksums |
ef57892b4d5732e3a9f4e80fcfee7860c2217eca2833eaadea101d77c4960dec
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp313-cp313-macosx_10_13_x86_64.whl
| Download URL | pybwa-2.3.2-cp313-cp313-macosx_10_13_x86_64.whl |
|---|---|
| Size | 3.6 MB |
| Tags | CPython 3.13 macOS 10.13+ x86-64 |
|
SHA-256 checksum How to use checksums |
30d37633a4b74a7a4a8dd1ae24b68a76f7c7d1d77ba122f655355815c8d25882
|
|
BLAKE2b-256 checksum How to use checksums |
13fc9707e5e41e32cc7ec69a258777a42407665b3c7e1daad0710337cda4dbc5
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp312-cp312-musllinux_1_2_x86_64.whl
| Download URL | pybwa-2.3.2-cp312-cp312-musllinux_1_2_x86_64.whl |
|---|---|
| Size | 13.2 MB |
| Tags | CPython 3.12 Linux musl 1.2+ x86-64 |
|
SHA-256 checksum How to use checksums |
6adfc5c794e1bc9c9f4ba14c8896f8f34c24cb782e79e34ab5a9c90258ad4048
|
|
BLAKE2b-256 checksum How to use checksums |
5c01eb9d2c7d6992a17e34f648b21dd4d8e96ad672cb85ac6e0da4b0484a806d
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp312-cp312-musllinux_1_2_aarch64.whl
| Download URL | pybwa-2.3.2-cp312-cp312-musllinux_1_2_aarch64.whl |
|---|---|
| Size | 12.9 MB |
| Tags | CPython 3.12 Linux musl 1.2+ ARM64 |
|
SHA-256 checksum How to use checksums |
84c9018844dd3fa0a31e3caf97948335f7623270887b84459e4e6b3750996cf3
|
|
BLAKE2b-256 checksum How to use checksums |
db90a9ca7bc93f4f369909109768719161c483794d74b23d43e5acb03ae63a26
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp312-cp312-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl
| Download URL | pybwa-2.3.2-cp312-cp312-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 13.4 MB |
| Tags | CPython 3.12 Linux glibc 2.27+ x86-64 Linux glibc 2.28+ x86-64 |
|
SHA-256 checksum How to use checksums |
c09dd797dd5a3b849f13d014a57c6c97c25bb66936a058131451feac488d8a1d
|
|
BLAKE2b-256 checksum How to use checksums |
28c675f22cccc759ff1e698eac1d2f44ba9970e1735e257eb8cfbb1e333c834e
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp312-cp312-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl
| Download URL | pybwa-2.3.2-cp312-cp312-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl |
|---|---|
| Size | 12.7 MB |
| Tags | CPython 3.12 Linux glibc 2.27+ ARM64 Linux glibc 2.28+ ARM64 |
|
SHA-256 checksum How to use checksums |
90eb2816302d21b449bc253128724079ef63edbe226729544e7fcf9aff52e05b
|
|
BLAKE2b-256 checksum How to use checksums |
bfd033b110adada5def10ea2c3c2791735c46ab802c2a46815c3165258657b87
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp312-cp312-macosx_11_0_arm64.whl
| Download URL | pybwa-2.3.2-cp312-cp312-macosx_11_0_arm64.whl |
|---|---|
| Size | 3.4 MB |
| Tags | CPython 3.12 macOS 11.0+ ARM64 |
|
SHA-256 checksum How to use checksums |
e5ccfc62583d931be2737d8204f53ed060e6fc36e042b3ce3d0b9158f9ba6e3a
|
|
BLAKE2b-256 checksum How to use checksums |
311895475851f2412b3c8baadfaf6f93d106f97ea7272ce8b2d7631ce459085c
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp312-cp312-macosx_10_13_x86_64.whl
| Download URL | pybwa-2.3.2-cp312-cp312-macosx_10_13_x86_64.whl |
|---|---|
| Size | 3.6 MB |
| Tags | CPython 3.12 macOS 10.13+ x86-64 |
|
SHA-256 checksum How to use checksums |
b7ceed64f1a56c3c9de9886ef4c9649d72a624b458b1b0b44a416390146da43c
|
|
BLAKE2b-256 checksum How to use checksums |
7492e712045452d99d332e15ecdc98478018d31acc1040a831f393b7eb3da4ba
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp311-cp311-musllinux_1_2_x86_64.whl
| Download URL | pybwa-2.3.2-cp311-cp311-musllinux_1_2_x86_64.whl |
|---|---|
| Size | 13.2 MB |
| Tags | CPython 3.11 Linux musl 1.2+ x86-64 |
|
SHA-256 checksum How to use checksums |
3362c0516fa8ff697763417fd0b5c7b157f3af4b0b07143eb41da709b4a1f759
|
|
BLAKE2b-256 checksum How to use checksums |
e40e3c558faf1b6eaaa4d766a784707e85550bdd789e8413d7fa6616c801b30d
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp311-cp311-musllinux_1_2_aarch64.whl
| Download URL | pybwa-2.3.2-cp311-cp311-musllinux_1_2_aarch64.whl |
|---|---|
| Size | 12.9 MB |
| Tags | CPython 3.11 Linux musl 1.2+ ARM64 |
|
SHA-256 checksum How to use checksums |
082a7841376aff6b1cb1a7e6faecd6998c7809bda26e51ecfb33c0864ebd4936
|
|
BLAKE2b-256 checksum How to use checksums |
4edc6d6fe993fef5b518f682606e3985ee3a3a6fa711d8273d7db135456760a6
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp311-cp311-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl
| Download URL | pybwa-2.3.2-cp311-cp311-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 13.4 MB |
| Tags | CPython 3.11 Linux glibc 2.27+ x86-64 Linux glibc 2.28+ x86-64 |
|
SHA-256 checksum How to use checksums |
9e525b905aeea1b5977c85d9f4342a5cca3a945e5295f839b1b7c50b883f4ced
|
|
BLAKE2b-256 checksum How to use checksums |
bc4303f8e01b222db2e7f6a201ec565c5bb67dab8d3454a96551ad48564b452b
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp311-cp311-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl
| Download URL | pybwa-2.3.2-cp311-cp311-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl |
|---|---|
| Size | 12.7 MB |
| Tags | CPython 3.11 Linux glibc 2.27+ ARM64 Linux glibc 2.28+ ARM64 |
|
SHA-256 checksum How to use checksums |
92a7faf63f0643a99fe3d08f36e38b2d8cfcf6ec2180a6e6054c015ab5845548
|
|
BLAKE2b-256 checksum How to use checksums |
c302cdc42aa0cc4614543be152c154f721f334b72a858d1224b842e8cfe5611d
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp311-cp311-macosx_11_0_arm64.whl
| Download URL | pybwa-2.3.2-cp311-cp311-macosx_11_0_arm64.whl |
|---|---|
| Size | 3.4 MB |
| Tags | CPython 3.11 macOS 11.0+ ARM64 |
|
SHA-256 checksum How to use checksums |
a24478f66a5ef681c470dc204af651434696190fb5f5f33ee6efa6a195804dad
|
|
BLAKE2b-256 checksum How to use checksums |
643b1c565f7d705835ff5517546d4ed4fc0dd09c3f7c767089664698c4f54bea
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp311-cp311-macosx_10_9_x86_64.whl
| Download URL | pybwa-2.3.2-cp311-cp311-macosx_10_9_x86_64.whl |
|---|---|
| Size | 3.6 MB |
| Tags | CPython 3.11 macOS 10.9+ x86-64 |
|
SHA-256 checksum How to use checksums |
651687b7a6e5094478749a8237bec4dd32f1583e765e836cef1516ee3a421f3b
|
|
BLAKE2b-256 checksum How to use checksums |
ea7c8a6b4afd6e473c2fcc5f40cf0939a11c4b66d250012329cf6bc4437f968d
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp310-cp310-musllinux_1_2_x86_64.whl
| Download URL | pybwa-2.3.2-cp310-cp310-musllinux_1_2_x86_64.whl |
|---|---|
| Size | 13.1 MB |
| Tags | CPython 3.10 Linux musl 1.2+ x86-64 |
|
SHA-256 checksum How to use checksums |
16bfa6d80a54d21b6cd96508576d93b83092ba0ac8be6e91a74a5d99f4012a56
|
|
BLAKE2b-256 checksum How to use checksums |
04c714f73303675bbe9a2c6c2c56999ccfe75555d829ff5623a35327f88a2f89
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp310-cp310-musllinux_1_2_aarch64.whl
| Download URL | pybwa-2.3.2-cp310-cp310-musllinux_1_2_aarch64.whl |
|---|---|
| Size | 12.8 MB |
| Tags | CPython 3.10 Linux musl 1.2+ ARM64 |
|
SHA-256 checksum How to use checksums |
3c9d7c5290af2cc3777599f14778de7a12e5b67ac48b62a39a0db048be5f8dd0
|
|
BLAKE2b-256 checksum How to use checksums |
b7e06a340d0c8c255b9f07537179f5e92bb94e97b88ad2b8681b1e36440bd978
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp310-cp310-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl
| Download URL | pybwa-2.3.2-cp310-cp310-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 13.3 MB |
| Tags | CPython 3.10 Linux glibc 2.27+ x86-64 Linux glibc 2.28+ x86-64 |
|
SHA-256 checksum How to use checksums |
5fa1dd4c38819a2d1f3a6ff0a1afe4cc55ada75009e400a369c4228b1964ea96
|
|
BLAKE2b-256 checksum How to use checksums |
a8bca9ed115e04c5acb38e3242ecd69ee8a7cb64a18c97cab0d1f5e60b3d3b19
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp310-cp310-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl
| Download URL | pybwa-2.3.2-cp310-cp310-manylinux_2_27_aarch64.manylinux_2_28_aarch64.whl |
|---|---|
| Size | 12.6 MB |
| Tags | CPython 3.10 Linux glibc 2.27+ ARM64 Linux glibc 2.28+ ARM64 |
|
SHA-256 checksum How to use checksums |
6c5f8b701663e1fe6f1c11d830d61d59a538fd50b46a92fea53fac8e9f10f8d7
|
|
BLAKE2b-256 checksum How to use checksums |
0bf7e648894a6c77cc1a6b509d218b6b507794511070819a9182c2ed52019ae9
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp310-cp310-macosx_11_0_arm64.whl
| Download URL | pybwa-2.3.2-cp310-cp310-macosx_11_0_arm64.whl |
|---|---|
| Size | 3.4 MB |
| Tags | CPython 3.10 macOS 11.0+ ARM64 |
|
SHA-256 checksum How to use checksums |
3692473cf3a4979f916fb1c0395258994383f6c5fd0f8b6e98b2930bd6a6a9a9
|
|
BLAKE2b-256 checksum How to use checksums |
d3c49505a395772d597a9dc522b5a39e9867de43858b7ea7231cff632f2d5e47
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logRelease files / pybwa-2.3.2-cp310-cp310-macosx_10_9_x86_64.whl
| Download URL | pybwa-2.3.2-cp310-cp310-macosx_10_9_x86_64.whl |
|---|---|
| Size | 3.6 MB |
| Tags | CPython 3.10 macOS 10.9+ x86-64 |
|
SHA-256 checksum How to use checksums |
c5e3241937150305ba05fc6c54e710c20cb83fd341d45c827a0e6d0f2e1c419a
|
|
BLAKE2b-256 checksum How to use checksums |
9050320502d8cf52abe04a7b83ba848454cb7a222b5b71e090dc08651789c346
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.13
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logSecurity for pybwa 2.3.2
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
Full provenance
All 29 files in this release have been uploaded with provenance metadata.
Attestation for pybwa-2.3.2.tar.gz
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jul 19, 2026.
Transparency logA note on package security
PyPI is a repository for distributing packages, not a service for auditing them. While third-party security researchers and our staff do their best to detect and remove malicious packages, PyPI cannot guarantee the quality, security or suitability of any given package.
To learn more about protecting yourself from malicious actors, visit our package security documentation.
