Utilities for interactive work with pydna:

• Open DNA sequences in ApE or SnapGene.
• PCR primer list
• Restriction enzyme list
• Download and cache GenBank records and sequence regions.

Installation

Requires Python 3.12.7 or later but below 4.0.

pip install pydna-utils

Settings

Settings are stored in pydna_config.toml in the user configuration directory chosen by platformdirs.

Normally:

• ~/.config/pydna_utils/pydna_config.toml on Linux
• %LOCALAPPDATA%\pydna_utils\pydna_utils\pydna_config.toml on Windows
• ~/Library/Application Support/pydna_utils/pydna_config.toml on MacOS

The recommended way to change settings is to open this file in your text editor and edit it directly:

from pydna_utils import open_config_file

open_config_file()  # this opens the file in you default text editor

Set your email and the paths for the features you use:

pydna_email = "you@example.com"
pydna_primers = "/path/to/primers.fasta"
pydna_enzymes = "/path/to/enzymes.txt"

Set pydna_ape_cmd and pydna_snapgene_cmd to the commands that launch your installed editors. The defaults contain machine-specific paths, so adjust them before use. Restart your Python session after changing settings.

To display settings or open the default cache directory:

from pydna_utils import tabulate_settings, open_cache_folder

print(tabulate_settings())

Open a sequence in an editor

from pydna.dseqrecord import Dseqrecord
from pydna_utils.editor import ape, snapgene

sequence = Dseqrecord("GGATCC")
ape(sequence)
# snapgene(sequence)

Primer list

Set pydna_primers to a text file containing primers in a format pydna can read, such as FASTA. Primers are loaded in reverse file order, so new primers can be added at the top. List indices start at zero.

from pydna_utils.myprimers import PrimerList

primers = PrimerList()
primer = primers[0]
print(primer.format("fasta"))

# Generate code containing only the primers accessed in this session.
print(primers.code(primers.accessed))

Example primer list

>2_example_primer
GCTAGCTACGATCGATGCTA
>1_example_primer
CGATGTCGACTTAGATCTCAC
>0_example_primer
GATCGGCCGGATCCAAATGA

With this file, primers[0] returns 0_example_primer.

Shared restriction enzyme list

Set pydna_enzymes to a text file containing enzyme names recognized by Biopython, separated by whitespace and or newlines, for example BamHI EcoRI HindIII.

from pydna_utils.myenzymes import myenzymes

print(myenzymes)

Example enzyme list

BamHI
EcoRI
HindIII

Cached GenBank access

Set pydna_email to your email address before downloading. Use an accession including its version. Each call returns a fresh Dseqrecord.

from pydna_utils.genbank import genbank

record = genbank("CS570233.1")
fragment = genbank("CS570233.1", seq_start=3, seq_stop=7)
reverse = genbank("CS570233.1", seq_start=3, seq_stop=7, strand=2)

Coordinates are one-based and inclusive. Records are stored as GenBank files in pydna_ncbi_cache_dir, normally ~/.cache/pydna_utils/ on Linux. Cached records can serve requests for contained regions without another download. Local slicing retains only features fully contained in the requested region.

Cached files do not expire or refresh automatically.

See GenBank cache details for cache behavior and how to refresh a record.