This is a pre-production deployment of Warehouse, however changes made here WILL affect the production instance of PyPI.
Latest Version Dependencies status unknown Test status unknown Test coverage unknown
Project Description
SCRAM
-----

--------------

SCRAM is lightweight Python package for aligning small RNA reads to one
or more reference sequences and producing publication-quality images.

Developed by Stephen Fletcher @ the laboratory of Prof. Bernie Carroll,
University of Queensland

--------------

*Installation:*

Scram is written in Python 2.7. Install scram and its dependencies with
``pip``:

``pip install scram``

Or download and extract the tarball, then run:

``python setup.py install``

--------------

*Input File Format:*

Reference File : DNA nucleotides only (AGCT) - FASTA format

Sequence File : Collapsed reads - DNA nucleotides only (AGCT) - FASTA
format

Post-processing of FASTQ reads to collapsed FASTA format can be carried
out using the `FASTX-Toolkit from the Hannon
Lab <http: hannonlab.cshl.edu="" fastx_toolkit=""/>`__. Collapsed reads are
unique, and contain the read count in the header.

An example of the required read file format:

``head seq1.fa``

::

>1-607041
TCGGACCAGGCATCATTCCCC
>2-202886
TCGGACCAGGCTTCATACCCC
>3-71446
TCCCAAATATAGACAAAGCA

--------------

*Usage:*

``scram analysis_type reference_file [-h] [-s1 SEQ_FILE_1] [-s2 SEQ_FILE_2] [-s3 SEQ_FILE_3] [-s4 SEQ_FILE_4] [-nt SRNA_LEN] [-f FILE_NAME] [-seq_list SEQ_LIST] [-min_read MIN_READ_SIZE] [-max_read MAX_READ_SIZE] [-min_count MIN_READ_COUNT] [-win SMOOTH_WIN_SIZE] [-ylim YLIM] [-no_display] [-split] [-pub] [-V]``

Analysis types

- **den** : align reads of a single sRNA class (eg. 21 nt) from a
single sequence file to a single reference sequence (-s1 and -nt
required)
- **mnt3dm** : align 21, 22 and 24 nt reads from a single sequence file
to a single reference sequence (-s1 required)
- **CDP** : count aligned reads of a single sRNA class (eg. 21 nt) to
multiple reference sequences. Counts for two sequence files are
plotted as (x,y) coordinates for each reference (-s1, -s2 and -nt
required)

Flags

- **-h** : Help message
- **-s1** : Sequence file 1
- **-s2** : Sequence file 2
- **-s3** : Sequence file 3
- **-s4** : Sequence file 4
- **-nt** : sRNA length to analyse
- **-f** : Figure output file name (if not auto-generated)
- **-p** : Number of cores (processors) to use (default=4)
- **-seq\_list** : Text (.txt) file with full path of sequence file on
each line (single replicate) or two tab-delimited sequence file paths
per line (two replicates)
- **-min\_read** : Minimum length of sRNA reads used for normalisation
(default=18)
- **-max\_read** : Maximum length of sRNA reads used for normalisation
(default=32)
- **-min\_count** : Minimum read count for an sRNA to be aligned and
used for normalisation (default=1)
- **-win** : Window size for smoothing of den plots (default=50)
- **-ylim** : +/- y-axis limit on plots
- **-no\_display** : Do not display plot on screen
- **-no\_csv** : Do not generate .csv alignment file
- **-split** : Split CDP read alignment counts based on no. of
alignments
- **-pub** : Remove all labels from density maps for publication
- **-V** : Show program's version number and exit

--------------

den example:

``scram den ./ref.fa -s1 seq1.fa -nt 24 -win 30 -f fig1.pdf``

mnt3dm Example:

``scram mnt3dm ./ref.fa -s1 seq1.fa -win 20 -ylim 110 -f fig2.pdf``

CDP Example:

``scram CDP ./cDNAs.fa -s1 seq1.fa -s2 seq2.fa -nt 21 -f fig3.pdf -split``

--------------

(c) 2016 - Stephen Fletcher. MIT License

Release History

Release History

0.6.3

This version

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.6.1

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.6.0

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.5.6

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.5.5

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.5.4

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.5.3

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.5.2

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.5.1

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.5.0

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.4.2

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.4.1

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.4

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.3

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.2

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

Download Files

Download Files

TODO: Brief introduction on what you do with files - including link to relevant help section.

File Name & Checksum SHA256 Checksum Help Version File Type Upload Date
scram-0.6.3.tar.gz (18.2 kB) Copy SHA256 Checksum SHA256 Source Oct 27, 2016

Supported By

WebFaction WebFaction Technical Writing Elastic Elastic Search Pingdom Pingdom Monitoring Dyn Dyn DNS HPE HPE Development Sentry Sentry Error Logging CloudAMQP CloudAMQP RabbitMQ Heroku Heroku PaaS Kabu Creative Kabu Creative UX & Design Fastly Fastly CDN DigiCert DigiCert EV Certificate Rackspace Rackspace Cloud Servers DreamHost DreamHost Log Hosting