scram 0.6.5

Small Complementary RnA Mapper

SCRAM
-----

--------------

SCRAM is lightweight Python package for aligning small RNA reads to one
or more reference sequences and producing publication-quality images.

Developed by Stephen Fletcher @ the laboratory of Prof. Bernie Carroll,
University of Queensland

--------------

*Installation:*

Scram is written in Python 2.7. Install scram and its dependencies with
``pip``:

``pip install scram``

Or download and extract the tarball, then run:

``python setup.py install``

--------------

*Input File Format:*

Reference File : DNA nucleotides only (AGCT) - FASTA format

Sequence File : Collapsed reads - DNA nucleotides only (AGCT) - FASTA
format

Post-processing of FASTQ reads to collapsed FASTA format can be carried
out using the `FASTX-Toolkit from the Hannon
Lab <http://hannonlab.cshl.edu/fastx_toolkit/>`__. Collapsed reads are
unique, and contain the read count in the header.

An example of the required read file format:

``head seq1.fa``

::

>1-607041
TCGGACCAGGCATCATTCCCC
>2-202886
TCGGACCAGGCTTCATACCCC
>3-71446
TCCCAAATATAGACAAAGCA

--------------

*Usage:*

``scram analysis_type reference_file [-h] [-s1 SEQ_FILE_1] [-s2 SEQ_FILE_2] [-s3 SEQ_FILE_3] [-s4 SEQ_FILE_4] [-nt SRNA_LEN] [-f FILE_NAME] [-seq_list SEQ_LIST] [-min_read MIN_READ_SIZE] [-max_read MAX_READ_SIZE] [-min_count MIN_READ_COUNT] [-win SMOOTH_WIN_SIZE] [-ylim YLIM] [-no_display] [-split] [-pub] [-V]``

Analysis types

- **den** : align reads of a single sRNA class (eg. 21 nt) from a
single sequence file to a single reference sequence (-s1 and -nt
required)
- **mnt3dm** : align 21, 22 and 24 nt reads from a single sequence file
to a single reference sequence (-s1 required)
- **CDP** : count aligned reads of a single sRNA class (eg. 21 nt) to
multiple reference sequences. Counts for two sequence files are
plotted as (x,y) coordinates for each reference (-s1, -s2 and -nt
required)

Flags

- **-h** : Help message
- **-s1** : Sequence file 1
- **-s2** : Sequence file 2
- **-s3** : Sequence file 3
- **-s4** : Sequence file 4
- **-nt** : sRNA length to analyse
- **-f** : Figure output file name (if not auto-generated)
- **-p** : Number of cores (processors) to use (default=4)
- **-seq\_list** : Text (.txt) file with full path of sequence file on
each line (single replicate) or two tab-delimited sequence file paths
per line (two replicates)
- **-min\_read** : Minimum length of sRNA reads used for normalisation
(default=18)
- **-max\_read** : Maximum length of sRNA reads used for normalisation
(default=32)
- **-min\_count** : Minimum read count for an sRNA to be aligned and
used for normalisation (default=1)
- **-win** : Window size for smoothing of den plots (default=50)
- **-ylim** : +/- y-axis limit on plots
- **-no\_display** : Do not display plot on screen
- **-no\_csv** : Do not generate .csv alignment file
- **-split** : Split CDP read alignment counts based on no. of
alignments
- **-pub** : Remove all labels from density maps for publication
- **-V** : Show program's version number and exit

--------------

den example:

``scram den ./ref.fa -s1 seq1.fa -nt 24 -win 30 -f fig1.pdf``

mnt3dm Example:

``scram mnt3dm ./ref.fa -s1 seq1.fa -win 20 -ylim 110 -f fig2.pdf``

CDP Example:

``scram CDP ./cDNAs.fa -s1 seq1.fa -s2 seq2.fa -nt 21 -f fig3.pdf -split``

--------------

(c) 2016 - Stephen Fletcher. MIT License