Accession-first preprocessing for public HT-SELEX with primer auto-inference
Project description
selexprep
Accession-first preprocessing for public HT-SELEX, with primer auto-inference and safe failure modes.
Give selexprep a public accession (or your own FASTQs) and it infers the
primer/constant regions from the reads, strips them, and emits clean per-round
random-region FASTAs + count tables — with an explicit confidence level and a
reproducible manifest. When it can't infer the library with confidence, it
says so and refuses to guess rather than emitting fabricated primers.
It's the step before the existing SELEX toolchain. Tools like FASTAptameR,
AptaSUITE, RaptGen, and AptaTrans assume you already have trimmed reads and
already know your primers. selexprep produces exactly those inputs, starting
from a raw public deposit.
accession ──▶ fetch ──▶ detect ────▶ extract ───▶ count ────▶ qc
(or local (infer (trim per (unique (flags +
FASTQs) primers) round) seqs) 4 plots)
run chains the whole thing for you; the individual verbs (fetch, detect,
extract, count, qc) are there for when you need to drive one stage by hand.
Status — v0.1. Feature-complete and CI-tested (Python 3.10 / 3.11 / 3.12), with one strict-xfail reserved for v0.2 read merging. Full inventory in What v0.1 ships.
Install
pip install selexprep # pulls in cutadapt, the only external dependency
selexprep --version
Python 3.10+. The only external tool is cutadapt, installed automatically.
Working from a clone instead? uv pip install -e . from the repo root.
Quick start
One accession, no primers supplied. The whole pipeline is one command.
Write a TSV listing one or more accessions, then point run at it. It fetches
each dataset, infers the primers from the read content, then extracts, counts,
and QCs — with nothing about the library supplied by you:
printf 'accession\nPRJNA615076\n' > accessions.tsv
selexprep run accessions.tsv --outdir out
That's the happy path. Everything for each accession lands under
out/<accession>/:
| Output | What it is |
|---|---|
library_report.json |
inferred primers + status (HIGH / MEDIUM / LOW / UNABLE_TO_INFER) |
round_NN/extracted.fasta.gz |
primer-stripped random region, one folder per round |
round_NN/counts.parquet |
unique sequences per round (reads, rank, RPM) |
qc/flags.yaml + 4 PNGs |
depth-aware QC flags + diagnostic plots |
selexprep_manifest.json |
reproducibility manifest (output hashes, dependency versions, CLI argv) |
A corpus-level out/run_summary.tsv spans every accession. If a batch is
interrupted, re-run the same command with --resume and finished datasets
are skipped.
Watch it run, offline, in under a minute.
examples/01_offline_toy_pipeline.ipynbexecutes the fulldetect → extract → count → qcpath on a tiny synthetic library — no network, no accession, no HPC. It's the fastest way to see what each stage produces before pointing the tool at real data.
Common situations
The situations people actually hit. Find yours.
"I don't have an accession yet"
Browse the bundled catalog of public SELEX deposits, then feed the hits to run:
selexprep catalog list --target IL-10RA --insdc-only
selexprep catalog show PRJEB12345
INSDC accessions are fetchable; figshare/zenodo rows are discovery-only pointers
(flagged in the fetchable column) that run can't retrieve in v0.1 —
--insdc-only filters the list to just the retrievable ones.
"I only have my own local FASTQs"
run is for accessions; for files already on disk, drive the stages yourself.
This is also how you inspect an intermediate or re-extract with corrected
primers:
# detect needs a round map — cross-round persistence is the key primer signal
printf 'file\tround_number\nround_00.fastq.gz\t0\nround_01.fastq.gz\t1\nround_02.fastq.gz\t2\n' > rounds.tsv
selexprep detect round_00.fastq.gz round_01.fastq.gz round_02.fastq.gz \
--round-map rounds.tsv --outdir ./out
selexprep extract round_00.fastq.gz round_01.fastq.gz round_02.fastq.gz \
--library-report ./out/library_report.json --round-map rounds.tsv --outdir ./out
for r in 0 1 2; do
selexprep count ./out/round_$(printf '%02d' $r)/extracted.fasta.gz --round R$r --outdir ./out
done
selexprep qc ./out/selexprep_manifest.json
The runnable, annotated version of exactly this path is
examples/01_offline_toy_pipeline.ipynb;
every flag and the --round-map contract are in the CLI reference.
"My reads are paired-end (R1 + R2)"
Common for modern Illumina SELEX — and handled for you from an accession:
run detects the paired layout at fetch time and threads R2 through with no
extra flags. By hand on local files, list the R1 files in the round map and
the matching R2 files via --paired-r2, in the same order, one R2 per R1:
printf 'file\tround_number\nr0_R1.fastq.gz\t0\nr1_R1.fastq.gz\t1\n' > rounds.tsv
selexprep detect r0_R1.fastq.gz r1_R1.fastq.gz \
--paired-r2 r0_R2.fastq.gz r1_R2.fastq.gz \
--round-map rounds.tsv --outdir ./out
selexprep extract r0_R1.fastq.gz r1_R1.fastq.gz \
--paired-r2 r0_R2.fastq.gz r1_R2.fastq.gz \
--library-report ./out/library_report.json --round-map rounds.tsv --outdir ./out
If the 5' primer sits on R1 and the 3' on R2, detect reports
extraction_mode: PAIRED_END_SPLIT_PRIMERS and extract writes the two trimmed
sides separately (partial_5p_extracted_R1… + partial_3p_extracted_R2…). v0.1
stops there on purpose: stitching the sides into one full-length insert is read
merging, a v0.2 item, so count/qc are skipped for split-primer rounds
rather than counting half-inserts.
"I only have the final enriched pool (a single round)"
The common case — HT-SELEX is costly, so many experiments sequence only the
final pool. selexprep still works; pass a one-row round map:
printf 'file\tround_number\nfinal_pool.fastq.gz\t0\n' > rounds.tsv
selexprep detect final_pool.fastq.gz --round-map rounds.tsv --outdir ./out
The one difference: confidence is capped at MEDIUM, because cross-round
persistence (the strongest SELEX-specific primer signal) needs ≥2 rounds.
detect warns and falls back to within-round signals (primer match rate, flank
position, low-entropy region, adapter blacklist). Verify the inferred primers
before trusting extraction — or, if you designed the library and know the
primers, pass them with --override-primer-5p/3p and the confidence cap no
longer applies (you're not inferring anything).
"detect returned UNABLE_TO_INFER"
By design, extract then refuses rather than guessing. Supply the primers
explicitly:
selexprep extract round_*.fastq.gz \
--library-report ./out/library_report.json --round-map rounds.tsv \
--override-primer-5p GGTAATACGACTCACTATAGGG \
--override-primer-3p CCATGCATGCATGCATGCAT \
--rebuild --outdir ./out
# --rebuild emits extract_diff.tsv comparing baseline vs override per round.
You can also edit library_report.json by hand and re-run without overrides.
Multiplexed deposit (several samples or targets pooled in one FASTQ)? v0.1 doesn't auto-split them — pass a
--sample-sheettoextractin place of--round-map. Auto-demultiplexing is a v0.2 item.
CLI reference
The core pipeline is inspect → fetch → detect → extract → count → qc; run
batches it and catalog browses the discovery catalog. Every command supports
--help; full reference in docs/cli.md.
| Command | What it does |
|---|---|
selexprep inspect <ACC> |
ENA metadata preview — round count, library_strategy (SRA verbatim), file sizes + MD5s. No download. |
selexprep fetch <ACC> --outdir OUT |
Download FASTQ + auto-populate rounds.tsv. Unassigned runs go to round_unknown/ only with --allow-manual-review. |
selexprep detect <fastq...> --round-map rounds.tsv --outdir OUT |
Auto-infer primers + library structure → library_report.json. |
selexprep extract <fastq...> --library-report LR.json --round-map rounds.tsv --outdir OUT |
Cutadapt trim + strand reorient + per-round FASTA + manifest. Accepts --paired-r2, --sample-sheet, --override-primer-{5p,3p}, --rebuild. |
selexprep count <extracted.fasta.gz> --round R0 --outdir OUT |
FASTA → counts.parquet (sequence, reads, rank, RPM). |
selexprep qc <manifest> --outdir OUT |
Depth-aware suspicion flags (YAML) + 4 PNG plots. |
selexprep run <accessions.tsv> --outdir OUT [--resume] |
Batch driver across many accessions; emits run_summary.tsv + per-accession outputs. |
selexprep catalog list | show | version | refresh |
Browse / refresh the bundled discovery catalog (238 entries; refresh hits live ENA). |
Full output layout
After a complete single-dataset run:
out/
├── library_report.json # primer inference + extraction_mode
├── selexprep_manifest.json # reproducibility anchor
├── trim_reports.json # cutadapt argv + n_in/n_out per round
├── strand_report.tsv # only if orientation ∈ {MIXED, REVERSE}
├── extract_diff.tsv # only with --rebuild + --override-primer-*
├── round_00/
│ ├── extracted.fasta.gz # full-insert recovery (BOTH_PRIMERS_SINGLE_READ)
│ │ # or partial_5p_extracted.fasta.gz (FIVE_PRIME_ONLY)
│ │ # or partial_3p_extracted.fasta.gz (THREE_PRIME_ONLY)
│ │ # or partial_5p_extracted_R1.fasta.gz + partial_3p_extracted_R2.fasta.gz (PAIRED_END_SPLIT_PRIMERS)
│ └── counts.parquet # unique sequences
├── round_NN/...
└── qc/
├── flags.yaml # depth-aware suspicion flags
├── read_retention.png # input vs extracted per round
├── primer_match_per_round.png
├── n_length_distribution.png # per-round N-region histograms (faceted)
└── per_round_panel.png # unique seqs + Shannon entropy + top-100 coverage
Output filenames deliberately distinguish full inserts (extracted.fasta.gz)
from one-sided partials (partial_5p_… / partial_3p_…) so downstream ML
pipelines never accidentally mix them.
Why it exists (the gap)
No maintained, pip-installable Python tool takes a public HT-SELEX accession or local FASTQ and produces trimmed per-round FASTAs + count tables + a provenance manifest without requiring the user to supply primers.
| Tool | Accession fetch? | Primer auto-inference? | Safe failure mode? |
|---|---|---|---|
| AptaSUITE (CLI + GUI) | ✗ | ✗ — user supplies | ✗ |
| FASTAptameR | ✗ — consumes already-trimmed | ✗ | ✗ |
| EasyDIVER+ (2025) | ✗ | ✗ — paired-end with known primers | ✗ |
| ht-selex-demo | ✗ | ✗ — Illumina adapters only (a trap selexprep guards against via known_adapter_hits) |
✗ |
| nf-core | ✗ (no SELEX pipelines exist) | — | — |
selexprep |
✓ — INSDC in v0.1; figshare/zenodo deferred | ✓ — cross-round persistence + adapter blacklist | ✓ — explicit LibraryReport.status ∈ {HIGH, MEDIUM, LOW, UNABLE_TO_INFER} |
The core inference idea: a true primer appears at a similar rate across all
rounds; late-round-enriched aptamer motifs do not. detect exploits this
cross-round persistence to separate constants from binders, and reports its
confidence in a typed LibraryReport (pydantic, strict-mypy) with explicit
extraction_mode, read_source, required_action, full_insert_recovered,
and status — no silent miscalls.
Benchmark headline: on a curated, paper-grounded set, selexprep recovers
SELEX primers directly from raw reads — with none supplied — and fails safe (no
fabricated primers) where inference is ambiguous. See
Benchmarks.
What v0.1 ships
catalog (238 public SELEX entries: 125 INSDC + 113 figshare/zenodo
passthrough; documented exclusions in bioprojects_excluded.csv) · inspect
(ENA metadata preview) · fetch (accession download with relaxed
partial-parseability contract) · detect (primer inference) · extract
(cutadapt-driven trimming + paired-end + strand handling) · count (per-round
unique sequences) · qc (suspicion flags + 4 PNG plots) · run (batch driver
with --resume).
Catalog discovery completeness is measured at 100% of ENA-typed-SELEX deposits in the v0.1.7 snapshot, with 21 documented exclusions for mis-labeled and gSELEX/genomic-fragment variants.
Deferred to v0.2: read merging for paired-end full-insert recovery ·
multiplex auto-detection (v0.1 needs a user-supplied sample sheet) ·
figshare/zenodo fetch backends · SELEXPREP_CATALOG_PATH env var for
user-supplied catalogs · AnnData export · BibTeX auto-citation · library-type
classification.
What v0.1 does not do
By design — these are handled by mature tools that consume selexprep's outputs:
| Step | Use |
|---|---|
| Clustering | FASTAptameR |
| Motif discovery | MEME · RaptGen-UI |
| Binding-affinity prediction | RaptGen · DeepSELEX · AptaTrans |
| 3D structure | ViennaRNA · RNAfold |
| Aptamer design | MAWS · RNAtranslator |
| Read merging (paired-end full-insert recovery) | bbmerge · vsearch · pear (v0.2 hook) |
Determinism + reproducibility
All .fasta.gz, .tsv, and .json outputs are byte-deterministic given
the same --sampling-seed: gzip headers use mtime=0, JSON keys are sorted
(int keys in numeric order), TSV rows are sorted. Two runs with identical inputs
- seed produce identical SHA256s; the manifest's
output_sha256is the audit anchor.
Parquet hashes are advisory (not guaranteed across pyarrow versions — the
manifest pins pyarrow_version instead). PNG plots are informational
(matplotlib output isn't byte-deterministic) and don't contribute to
output_sha256.
Benchmarks
Two-tier benchmark under benchmarks/:
- Tier 1 — primer-recovery scorecard (
Snakefile+ground_truth.tsv): curated primer-recovery validation against paper-reported primers (N=11 source-verified accessions, modality-diverse), reported as a per-deposit table. - Tier 2 — corpus audit (
audit.smk): corpus utility audit over a random sample of audit-eligible INSDC catalog rows. Shipped artifacts underbenchmarks/audit_results/; the reproducibility envelope (catalog version + sample sha256 + seed) is committed. - Catalog completeness audit (
catalog_completeness_audit.py): re-runnable script diffingbioprojects.csvagainst ENA'slibrary_strategy="SELEX"set. Snapshot: 100% discovery / 79.6% auditable (82/103).
Calibration status
Tests assert on behavior, never on threshold values (e.g.
assert report.status == "HIGH", never assert HIGH_CUTOFF == 0.85), so tuning
the numbers is safe under the suite. CALIBRATION-REVIEWED markers in
library/detect.py document vetted v0.1 thresholds with rationale;
CALIBRATION-TODO markers (in qc/flags.py, library/adapters.py,
extract/strand.py) flag what's still pending.
grep -rn "CALIBRATION-TODO" src/ # what's left to tune
grep -rn "CALIBRATION-REVIEWED" src/ # what's already vetted with rationale
Development
uv run pytest # full suite + 1 reserved xfail
uv run ruff check src/ tests/
uv run ruff format --check src/ tests/
uv run mypy src/ # strict on library.report
CI matrix: Python 3.10 / 3.11 / 3.12.
License
MIT. See LICENSE. Full development log in CHANGELOG.md.
Project details
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file selexprep-0.1.1.tar.gz.
File metadata
- Download URL: selexprep-0.1.1.tar.gz
- Upload date:
- Size: 688.2 kB
- Tags: Source
- Uploaded using Trusted Publishing? Yes
- Uploaded via: twine/6.1.0 CPython/3.13.12
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
66da56c90480e337d621a85c3558075bd43adef1cdc0934acf0cdec57a09d387
|
|
| MD5 |
b6938f29d31e49b81a353bb3e66be8d9
|
|
| BLAKE2b-256 |
629644c341098f6788ac1d1e63ae82568597884cf6d77b4a345324b53b712542
|
Provenance
The following attestation bundles were made for selexprep-0.1.1.tar.gz:
Publisher:
release.yml on marcorotanegroni/selexprep
-
Statement:
-
Statement type:
https://in-toto.io/Statement/v1 -
Predicate type:
https://docs.pypi.org/attestations/publish/v1 -
Subject name:
selexprep-0.1.1.tar.gz -
Subject digest:
66da56c90480e337d621a85c3558075bd43adef1cdc0934acf0cdec57a09d387 - Sigstore transparency entry: 1836092251
- Sigstore integration time:
-
Permalink:
marcorotanegroni/selexprep@3b4b52204e2b6334f2be330d5166bd73a9ecf501 -
Branch / Tag:
refs/tags/v0.1.1 - Owner: https://github.com/marcorotanegroni
-
Access:
public
-
Token Issuer:
https://token.actions.githubusercontent.com -
Runner Environment:
github-hosted -
Publication workflow:
release.yml@3b4b52204e2b6334f2be330d5166bd73a9ecf501 -
Trigger Event:
release
-
Statement type:
File details
Details for the file selexprep-0.1.1-py3-none-any.whl.
File metadata
- Download URL: selexprep-0.1.1-py3-none-any.whl
- Upload date:
- Size: 250.2 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? Yes
- Uploaded via: twine/6.1.0 CPython/3.13.12
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
d41fdf6a39977d87cddcb341f9890bf5946179aea433386421fa7490457689bd
|
|
| MD5 |
2717bb1b52306416f09e7660ebba66e3
|
|
| BLAKE2b-256 |
9f5cdc06d2fcb5c922144d4c8b618e39e8ed8cb8354cfadc9602cf7e1e5c6dbd
|
Provenance
The following attestation bundles were made for selexprep-0.1.1-py3-none-any.whl:
Publisher:
release.yml on marcorotanegroni/selexprep
-
Statement:
-
Statement type:
https://in-toto.io/Statement/v1 -
Predicate type:
https://docs.pypi.org/attestations/publish/v1 -
Subject name:
selexprep-0.1.1-py3-none-any.whl -
Subject digest:
d41fdf6a39977d87cddcb341f9890bf5946179aea433386421fa7490457689bd - Sigstore transparency entry: 1836092358
- Sigstore integration time:
-
Permalink:
marcorotanegroni/selexprep@3b4b52204e2b6334f2be330d5166bd73a9ecf501 -
Branch / Tag:
refs/tags/v0.1.1 - Owner: https://github.com/marcorotanegroni
-
Access:
public
-
Token Issuer:
https://token.actions.githubusercontent.com -
Runner Environment:
github-hosted -
Publication workflow:
release.yml@3b4b52204e2b6334f2be330d5166bd73a9ecf501 -
Trigger Event:
release
-
Statement type: