Skip to main content

Accession-first preprocessing for public HT-SELEX with primer auto-inference

Project description

selexprep

Tests License: MIT Python

Accession-first preprocessing for public HT-SELEX, with primer auto-inference and safe failure modes.

Give selexprep a public accession (or your own FASTQs) and it infers the primer/constant regions from the reads, strips them, and emits clean per-round random-region FASTAs + count tables — with an explicit confidence level and a reproducible manifest. When it can't infer the library with confidence, it says so and refuses to guess rather than emitting fabricated primers.

It's the step before the existing SELEX toolchain. Tools like FASTAptameR, AptaSUITE, RaptGen, and AptaTrans assume you already have trimmed reads and already know your primers. selexprep produces exactly those inputs, starting from a raw public deposit.

  accession ──▶ fetch ──▶ detect ────▶ extract ───▶ count ────▶ qc
 (or local             (infer        (trim per     (unique     (flags +
  FASTQs)               primers)      round)        seqs)       4 plots)

run chains the whole thing for you; the individual verbs (fetch, detect, extract, count, qc) are there for when you need to drive one stage by hand.

Status — v0.1. Feature-complete and CI-tested (Python 3.10 / 3.11 / 3.12), with one strict-xfail reserved for v0.2 read merging. Full inventory in What v0.1 ships.


Install

pip install selexprep        # pulls in cutadapt, the only external dependency
selexprep --version

Python 3.10+. The only external tool is cutadapt, installed automatically. Working from a clone instead? uv pip install -e . from the repo root.

Quick start

One accession, no primers supplied. The whole pipeline is one command. Write a TSV listing one or more accessions, then point run at it. It fetches each dataset, infers the primers from the read content, then extracts, counts, and QCs — with nothing about the library supplied by you:

printf 'accession\nPRJNA615076\n' > accessions.tsv
selexprep run accessions.tsv --outdir out

That's the happy path. Everything for each accession lands under out/<accession>/:

Output What it is
library_report.json inferred primers + status (HIGH / MEDIUM / LOW / UNABLE_TO_INFER)
round_NN/extracted.fasta.gz primer-stripped random region, one folder per round
round_NN/counts.parquet unique sequences per round (reads, rank, RPM)
qc/flags.yaml + 4 PNGs depth-aware QC flags + diagnostic plots
selexprep_manifest.json reproducibility manifest (output hashes, dependency versions, CLI argv)

A corpus-level out/run_summary.tsv spans every accession. If a batch is interrupted, re-run the same command with --resume and finished datasets are skipped.

Watch it run, offline, in under a minute. examples/01_offline_toy_pipeline.ipynb executes the full detect → extract → count → qc path on a tiny synthetic library — no network, no accession, no HPC. It's the fastest way to see what each stage produces before pointing the tool at real data.

Common situations

The situations people actually hit. Find yours.

"I don't have an accession yet"

Browse the bundled catalog of public SELEX deposits, then feed the hits to run:

selexprep catalog list --target IL-10RA --insdc-only
selexprep catalog show PRJEB12345

INSDC accessions are fetchable; figshare/zenodo rows are discovery-only pointers (flagged in the fetchable column) that run can't retrieve in v0.1 — --insdc-only filters the list to just the retrievable ones.

"I only have my own local FASTQs"

run is for accessions; for files already on disk, drive the stages yourself. This is also how you inspect an intermediate or re-extract with corrected primers:

# detect needs a round map — cross-round persistence is the key primer signal
printf 'file\tround_number\nround_00.fastq.gz\t0\nround_01.fastq.gz\t1\nround_02.fastq.gz\t2\n' > rounds.tsv

selexprep detect round_00.fastq.gz round_01.fastq.gz round_02.fastq.gz \
    --round-map rounds.tsv --outdir ./out

selexprep extract round_00.fastq.gz round_01.fastq.gz round_02.fastq.gz \
    --library-report ./out/library_report.json --round-map rounds.tsv --outdir ./out

for r in 0 1 2; do
    selexprep count ./out/round_$(printf '%02d' $r)/extracted.fasta.gz --round R$r --outdir ./out
done

selexprep qc ./out/selexprep_manifest.json

The runnable, annotated version of exactly this path is examples/01_offline_toy_pipeline.ipynb; every flag and the --round-map contract are in the CLI reference.

"My reads are paired-end (R1 + R2)"

Common for modern Illumina SELEX — and handled for you from an accession: run detects the paired layout at fetch time and threads R2 through with no extra flags. By hand on local files, list the R1 files in the round map and the matching R2 files via --paired-r2, in the same order, one R2 per R1:

printf 'file\tround_number\nr0_R1.fastq.gz\t0\nr1_R1.fastq.gz\t1\n' > rounds.tsv

selexprep detect r0_R1.fastq.gz r1_R1.fastq.gz \
    --paired-r2 r0_R2.fastq.gz r1_R2.fastq.gz \
    --round-map rounds.tsv --outdir ./out

selexprep extract r0_R1.fastq.gz r1_R1.fastq.gz \
    --paired-r2 r0_R2.fastq.gz r1_R2.fastq.gz \
    --library-report ./out/library_report.json --round-map rounds.tsv --outdir ./out

If the 5' primer sits on R1 and the 3' on R2, detect reports extraction_mode: PAIRED_END_SPLIT_PRIMERS and extract writes the two trimmed sides separately (partial_5p_extracted_R1… + partial_3p_extracted_R2…). v0.1 stops there on purpose: stitching the sides into one full-length insert is read merging, a v0.2 item, so count/qc are skipped for split-primer rounds rather than counting half-inserts.

"I only have the final enriched pool (a single round)"

The common case — HT-SELEX is costly, so many experiments sequence only the final pool. selexprep still works; pass a one-row round map:

printf 'file\tround_number\nfinal_pool.fastq.gz\t0\n' > rounds.tsv
selexprep detect final_pool.fastq.gz --round-map rounds.tsv --outdir ./out

The one difference: confidence is capped at MEDIUM, because cross-round persistence (the strongest SELEX-specific primer signal) needs ≥2 rounds. detect warns and falls back to within-round signals (primer match rate, flank position, low-entropy region, adapter blacklist). Verify the inferred primers before trusting extraction — or, if you designed the library and know the primers, pass them with --override-primer-5p/3p and the confidence cap no longer applies (you're not inferring anything).

"detect returned UNABLE_TO_INFER"

By design, extract then refuses rather than guessing. Supply the primers explicitly:

selexprep extract round_*.fastq.gz \
    --library-report ./out/library_report.json --round-map rounds.tsv \
    --override-primer-5p GGTAATACGACTCACTATAGGG \
    --override-primer-3p CCATGCATGCATGCATGCAT \
    --rebuild --outdir ./out
# --rebuild emits extract_diff.tsv comparing baseline vs override per round.

You can also edit library_report.json by hand and re-run without overrides.

Multiplexed deposit (several samples or targets pooled in one FASTQ)? v0.1 doesn't auto-split them — pass a --sample-sheet to extract in place of --round-map. Auto-demultiplexing is a v0.2 item.

CLI reference

The core pipeline is inspect → fetch → detect → extract → count → qc; run batches it and catalog browses the discovery catalog. Every command supports --help; full reference in docs/cli.md.

Command What it does
selexprep inspect <ACC> ENA metadata preview — round count, library_strategy (SRA verbatim), file sizes + MD5s. No download.
selexprep fetch <ACC> --outdir OUT Download FASTQ + auto-populate rounds.tsv. Unassigned runs go to round_unknown/ only with --allow-manual-review.
selexprep detect <fastq...> --round-map rounds.tsv --outdir OUT Auto-infer primers + library structure → library_report.json.
selexprep extract <fastq...> --library-report LR.json --round-map rounds.tsv --outdir OUT Cutadapt trim + strand reorient + per-round FASTA + manifest. Accepts --paired-r2, --sample-sheet, --override-primer-{5p,3p}, --rebuild.
selexprep count <extracted.fasta.gz> --round R0 --outdir OUT FASTA → counts.parquet (sequence, reads, rank, RPM).
selexprep qc <manifest> --outdir OUT Depth-aware suspicion flags (YAML) + 4 PNG plots.
selexprep run <accessions.tsv> --outdir OUT [--resume] Batch driver across many accessions; emits run_summary.tsv + per-accession outputs.
selexprep catalog list | show | version | refresh Browse / refresh the bundled discovery catalog (238 entries; refresh hits live ENA).

Full output layout

After a complete single-dataset run:

out/
├── library_report.json            # primer inference + extraction_mode
├── selexprep_manifest.json        # reproducibility anchor
├── trim_reports.json              # cutadapt argv + n_in/n_out per round
├── strand_report.tsv              # only if orientation ∈ {MIXED, REVERSE}
├── extract_diff.tsv               # only with --rebuild + --override-primer-*
├── round_00/
│   ├── extracted.fasta.gz         # full-insert recovery (BOTH_PRIMERS_SINGLE_READ)
│   │   # or partial_5p_extracted.fasta.gz (FIVE_PRIME_ONLY)
│   │   # or partial_3p_extracted.fasta.gz (THREE_PRIME_ONLY)
│   │   # or partial_5p_extracted_R1.fasta.gz + partial_3p_extracted_R2.fasta.gz (PAIRED_END_SPLIT_PRIMERS)
│   └── counts.parquet             # unique sequences
├── round_NN/...
└── qc/
    ├── flags.yaml                 # depth-aware suspicion flags
    ├── read_retention.png         # input vs extracted per round
    ├── primer_match_per_round.png
    ├── n_length_distribution.png  # per-round N-region histograms (faceted)
    └── per_round_panel.png        # unique seqs + Shannon entropy + top-100 coverage

Output filenames deliberately distinguish full inserts (extracted.fasta.gz) from one-sided partials (partial_5p_… / partial_3p_…) so downstream ML pipelines never accidentally mix them.


Why it exists (the gap)

No maintained, pip-installable Python tool takes a public HT-SELEX accession or local FASTQ and produces trimmed per-round FASTAs + count tables + a provenance manifest without requiring the user to supply primers.

Tool Accession fetch? Primer auto-inference? Safe failure mode?
AptaSUITE (CLI + GUI) ✗ — user supplies
FASTAptameR ✗ — consumes already-trimmed
EasyDIVER+ (2025) ✗ — paired-end with known primers
ht-selex-demo ✗ — Illumina adapters only (a trap selexprep guards against via known_adapter_hits)
nf-core ✗ (no SELEX pipelines exist)
selexprep ✓ — INSDC in v0.1; figshare/zenodo deferred ✓ — cross-round persistence + adapter blacklist ✓ — explicit LibraryReport.status ∈ {HIGH, MEDIUM, LOW, UNABLE_TO_INFER}

The core inference idea: a true primer appears at a similar rate across all rounds; late-round-enriched aptamer motifs do not. detect exploits this cross-round persistence to separate constants from binders, and reports its confidence in a typed LibraryReport (pydantic, strict-mypy) with explicit extraction_mode, read_source, required_action, full_insert_recovered, and status — no silent miscalls.

Benchmark headline: on a curated, paper-grounded set, selexprep recovers SELEX primers directly from raw reads — with none supplied — and fails safe (no fabricated primers) where inference is ambiguous. See Benchmarks.

What v0.1 ships

catalog (238 public SELEX entries: 125 INSDC + 113 figshare/zenodo passthrough; documented exclusions in bioprojects_excluded.csv) · inspect (ENA metadata preview) · fetch (accession download with relaxed partial-parseability contract) · detect (primer inference) · extract (cutadapt-driven trimming + paired-end + strand handling) · count (per-round unique sequences) · qc (suspicion flags + 4 PNG plots) · run (batch driver with --resume).

Catalog discovery completeness is measured at 100% of ENA-typed-SELEX deposits in the v0.1.7 snapshot, with 21 documented exclusions for mis-labeled and gSELEX/genomic-fragment variants.

Deferred to v0.2: read merging for paired-end full-insert recovery · multiplex auto-detection (v0.1 needs a user-supplied sample sheet) · figshare/zenodo fetch backends · SELEXPREP_CATALOG_PATH env var for user-supplied catalogs · AnnData export · BibTeX auto-citation · library-type classification.

What v0.2 adds

Curated metadata layer (selexprep.catalog.load_metadata / load_metadata_records) — each of the 238 catalog deposits now ships with curated experimental metadata: study_type, target, target_class, chemistry, n_random, n_rounds, selection_format, counter_selection (238 × 8 = 1904 cells, 1479 populated — up from ~4 experimental-field cells in v0.1). Built by two independent LLM extractions (Claude + Codex/GPT), reconciled, with every value source-cited (evidence quote + DOI/URL + location); where the two extractions genuinely disagreed, both are kept. Bundled as curated_metadata.json (canonical, provenance-rich) + curated_metadata.csv (flat view) under catalog/data/, accessed via the API above. Spot-checked against the hand-curated benchmark ground truth (overlapping fields on 11 verified deposits) — no residual disagreements after adjudication. The extraction contract, both raw arms, and the reconciliation live under benchmarks/dual_extraction/ (not shipped on PyPI).

What v0.1 does not do

By design — these are handled by mature tools that consume selexprep's outputs:

Step Use
Clustering FASTAptameR
Motif discovery MEME · RaptGen-UI
Binding-affinity prediction RaptGen · DeepSELEX · AptaTrans
3D structure ViennaRNA · RNAfold
Aptamer design MAWS · RNAtranslator
Read merging (paired-end full-insert recovery) bbmerge · vsearch · pear (v0.2 hook)

Determinism + reproducibility

All .fasta.gz, .tsv, and .json outputs are byte-deterministic given the same --sampling-seed: gzip headers use mtime=0, JSON keys are sorted (int keys in numeric order), TSV rows are sorted. Two runs with identical inputs

  • seed produce identical SHA256s; the manifest's output_sha256 is the audit anchor.

Parquet hashes are advisory (not guaranteed across pyarrow versions — the manifest pins pyarrow_version instead). PNG plots are informational (matplotlib output isn't byte-deterministic) and don't contribute to output_sha256.

Benchmarks

Two-tier benchmark under benchmarks/:

  • Tier 1 — primer-recovery scorecard (Snakefile + ground_truth.tsv): curated primer-recovery validation against paper-reported primers (N=11 source-verified accessions, modality-diverse), reported as a per-deposit table.
  • Tier 2 — corpus audit (audit.smk): corpus utility audit over a random sample of audit-eligible INSDC catalog rows. Shipped artifacts under benchmarks/audit_results/; the reproducibility envelope (catalog version + sample sha256 + seed) is committed.
  • Catalog completeness audit (catalog_completeness_audit.py): re-runnable script diffing bioprojects.csv against ENA's library_strategy="SELEX" set. Snapshot: 100% discovery / 79.6% auditable (82/103).

Calibration status

Tests assert on behavior, never on threshold values (e.g. assert report.status == "HIGH", never assert HIGH_CUTOFF == 0.85), so tuning the numbers is safe under the suite. CALIBRATION-REVIEWED markers in library/detect.py document vetted v0.1 thresholds with rationale; CALIBRATION-TODO markers (in qc/flags.py, library/adapters.py, extract/strand.py) flag what's still pending.

grep -rn "CALIBRATION-TODO" src/      # what's left to tune
grep -rn "CALIBRATION-REVIEWED" src/  # what's already vetted with rationale

Development

uv run pytest                       # full suite + 1 reserved xfail
uv run ruff check src/ tests/
uv run ruff format --check src/ tests/
uv run mypy src/                     # strict on library.report

CI matrix: Python 3.10 / 3.11 / 3.12.

License

MIT. See LICENSE. Full development log in CHANGELOG.md.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

selexprep-0.2.0.tar.gz (1.1 MB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

selexprep-0.2.0-py3-none-any.whl (384.2 kB view details)

Uploaded Python 3

File details

Details for the file selexprep-0.2.0.tar.gz.

File metadata

  • Download URL: selexprep-0.2.0.tar.gz
  • Upload date:
  • Size: 1.1 MB
  • Tags: Source
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/6.1.0 CPython/3.13.12

File hashes

Hashes for selexprep-0.2.0.tar.gz
Algorithm Hash digest
SHA256 900b9c46f2829b4edd4a50e49f107b95201ac7e47e1730308811483dac1aa00c
MD5 2a309cb73019a524c7b48a7635320ca5
BLAKE2b-256 922b2ed0fc720111c0664378a58e47e2139c0bc7d2b284fc5a97e3ade865851f

See more details on using hashes here.

Provenance

The following attestation bundles were made for selexprep-0.2.0.tar.gz:

Publisher: release.yml on marcorotanegroni/selexprep

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file selexprep-0.2.0-py3-none-any.whl.

File metadata

  • Download URL: selexprep-0.2.0-py3-none-any.whl
  • Upload date:
  • Size: 384.2 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/6.1.0 CPython/3.13.12

File hashes

Hashes for selexprep-0.2.0-py3-none-any.whl
Algorithm Hash digest
SHA256 41520fba6d055baa611e46df029aa659f40bf707f742b5f2149fa4f6cf2cfc93
MD5 7ac385a2696284eb864d92616f625785
BLAKE2b-256 4779c744968bb4e9b56a78d4f945a839937d60c5cc9d83e91bf533df84ffead2

See more details on using hashes here.

Provenance

The following attestation bundles were made for selexprep-0.2.0-py3-none-any.whl:

Publisher: release.yml on marcorotanegroni/selexprep

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page