Skip to main content

seqfold

PyPI version DOI

Predict the minimum free energy structure of nucleic acids.

seqfold is an implementation of the Zuker, 1981 dynamic programming algorithm, the basis for UNAFold/mfold, with energy functions from SantaLucia, 2004 (DNA) and Turner, 2009 (RNA).

The folding/Tm engine is written in Rust and exposed to Python through PyO3/maturin.

Installation

Conda

conda install -c bioconda seqfold

Thank you to @jonas-fuchs for this.

pip

pip install seqfold

Prebuilt wheels include the compiled Rust extension, so no Rust toolchain is needed to install.

Usage

Python

from seqfold import fold, dg, dg_cache, dot_bracket

# just returns minimum free energy
dg("GGGAGGTCGTTACATCTGGGTAACACCGGTACTGATCCGGTGACCTCCC", temp = 37.0)  # -13.4

# `fold` returns a list of `seqfold.Struct` from the minimum free energy structure
structs = fold("GGGAGGTCGTTACATCTGGGTAACACCGGTACTGATCCGGTGACCTCCC")
print(sum(s.e for s in structs))  # -13.4, same as dg()
for struct in structs:
    print(struct)  # prints the i, j, ddg, and description of each structure

# `dg_cache` returns a 2D array where each (i,j) combination returns the MFE from i to j inclusive
cache = dg_cache("GGGAGGTCGTTACATCTGGGTAACACCGGTACTGATCCGGTGACCTCCC")

# `dot_bracket` returns a dot_bracket representation of the folding
print(dot_bracket(seq, structs))  # ((((((((.((((......))))..((((.......)))).))))))))

CLI

usage: seqfold [-h] [-t FLOAT] [-d] [-r] [--version] SEQ

Predict the minimum free energy (kcal/mol) of a nucleic acid sequence

positional arguments:
  SEQ                   nucleic acid sequence to fold

optional arguments:
  -h, --help            show this help message and exit
  -t FLOAT, --celcius FLOAT
                        temperature in Celsius
  -d, --dot-bracket     write a dot-bracket of the MFE folding to stdout
  -r, --sub-structures  write each substructure of the MFE folding to stdout
  --version             show program's version number and exit

Examples

$ seqfold GGGAGGTCGTTACATCTGGGTAACACCGGTACTGATCCGGTGACCTCCC --celcius 32
-15.3
$ seqfold GGGAGGTCGTTACATCTGGGTAACACCGGTACTGATCCGGTGACCTCCC --celcius 32 --dot-bracket --sub-structures
GGGAGGTCGTTACATCTGGGTAACACCGGTACTGATCCGGTGACCTCCC
((((((((.((((......))))..((((.......)))).))))))))
   i    j    ddg  description
   0   48   -1.9  STACK:GG/CC
   1   47   -1.9  STACK:GG/CC
   2   46   -1.4  STACK:GA/CT
   3   45   -1.4  STACK:AG/TC
   4   44   -1.9  STACK:GG/CC
   5   43   -1.6  STACK:GT/CA
   6   42   -1.4  STACK:TC/AG
   7   41   -0.5  BIFURCATION:4n/3h
   9   22   -1.1  STACK:TT/AA
  10   21   -0.7  STACK:TA/AT
  11   20   -1.6  STACK:AC/TG
  12   19    3.0  HAIRPIN:CA/GG
  25   39   -1.9  STACK:CC/GG
  26   38   -2.3  STACK:CG/GC
  27   37   -1.9  STACK:GG/CC
  28   36    3.2  HAIRPIN:GT/CT
-15.3

Notes

  • The type of nucleic acid, DNA or RNA, is inferred from the input sequence.
  • seqfold is case-insensitive with the input sequence.
  • The default temperature is 37 degrees Celsius for both the Python and CLI interface.

Motivation

Secondary structure prediction is used for making PCR primers, designing oligos for MAGE, and tuning RBS expression rates.

While UNAFold and mfold are the most widely used applications for nucleic acid secondary structure prediction, their format and license are restrictive. seqfold is meant to be an open-source, minimalist alternative for predicting minimum free energy secondary structure.

seqfold mfold UNAFold
License MIT Academic Non-commercial $200-36,000
OS Linux, MacOS, Windows Linux, MacOS Linux, MacOS, Windows
Format python, CLI python CLI binary CLI binary
Dependencies none (mfold_util) Perl, (gnuplot, glut/OpenGL)
Graphical no yes (output) yes (output)
Heterodimers no yes yes
Constraints no yes yes

Citations

Papers, and how they helped in developing seqfold, are listed below.

Nussinov, 1980

Nussinov, Ruth, and Ann B. Jacobson. "Fast algorithm for predicting the secondary structure of single-stranded RNA." Proceedings of the National Academy of Sciences 77.11 (1980): 6309-6313.

Framework for the dynamic programming approach. It has a conceptually helpful "Maximal Matching" example that demonstrates the approach on a simple sequence with only matched or unmatched bp.

Zuker, 1981

Zuker, Michael, and Patrick Stiegler. "Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information." Nucleic acids research 9.1 (1981): 133-148.

The most cited paper in this space. Extends further than Nussinov, 1980 with a nearest neighbor approach to energies and a consideration of each of stack, bulge, internal loop, and hairpin. Their data structure and traceback method are both more intuitive than Nussinov, 1980.

Jaeger, 1989

Jaeger, John A., Douglas H. Turner, and Michael Zuker. "Improved predictions of secondary structures for RNA." Proceedings of the National Academy of Sciences 86.20 (1989): 7706-7710.

Zuker and colleagues expand on the 1981 paper to incorporate penalties for multibranched loops and dangling ends.

SantaLucia, 2004

SantaLucia Jr, John, and Donald Hicks. "The thermodynamics of DNA structural motifs." Annu. Rev. Biophys. Biomol. Struct. 33 (2004): 415-440.

The paper from which almost every DNA energy function in seqfold comes from (with the exception of multibranch loops). Provides neighbor entropies and enthalpies for stacks, mismatching stacks, terminal stacks, and dangling stacks. Ditto for bulges, internal loops, and hairpins.

Turner, 2009

Turner, Douglas H., and David H. Mathews. "NNDB: the nearest neighbor parameter database for predicting stability of nucleic acid secondary structure." Nucleic acids research 38.suppl_1 (2009): D280-D282.

Source of RNA nearest neighbor change in entropy and enthalpy parameter data. In /data.

Ward, 2017

Ward, M., Datta, A., Wise, M., & Mathews, D. H. (2017). Advanced multi-loop algorithms for RNA secondary structure prediction reveal that the simplest model is best. Nucleic acids research, 45(14), 8541-8550.

An investigation of energy functions for multibranch loops that validates the simple linear approach employed by Jaeger, 1989 that keeps runtime within O(n³).

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

seqfold-0.10.2.tar.gz (51.3 kB view details)

Uploaded Source

Built Distributions

If you're not sure about the file name format, learn more about wheel file names.

seqfold-0.10.2-cp38-abi3-win_arm64.whl (252.2 kB view details)

Uploaded CPython 3.8+Windows ARM64

seqfold-0.10.2-cp38-abi3-win_amd64.whl (263.3 kB view details)

Uploaded CPython 3.8+Windows x86-64

seqfold-0.10.2-cp38-abi3-musllinux_1_2_x86_64.whl (608.6 kB view details)

Uploaded CPython 3.8+musllinux: musl 1.2+ x86-64

seqfold-0.10.2-cp38-abi3-musllinux_1_2_aarch64.whl (569.2 kB view details)

Uploaded CPython 3.8+musllinux: musl 1.2+ ARM64

seqfold-0.10.2-cp38-abi3-manylinux_2_17_x86_64.manylinux2014_x86_64.whl (393.3 kB view details)

Uploaded CPython 3.8+manylinux: glibc 2.17+ x86-64

seqfold-0.10.2-cp38-abi3-manylinux_2_17_aarch64.manylinux2014_aarch64.whl (391.7 kB view details)

Uploaded CPython 3.8+manylinux: glibc 2.17+ ARM64

seqfold-0.10.2-cp38-abi3-macosx_11_0_arm64.whl (358.4 kB view details)

Uploaded CPython 3.8+macOS 11.0+ ARM64

seqfold-0.10.2-cp38-abi3-macosx_10_12_x86_64.whl (358.9 kB view details)

Uploaded CPython 3.8+macOS 10.12+ x86-64

File details

Details for the file seqfold-0.10.2.tar.gz.

File metadata

  • Download URL: seqfold-0.10.2.tar.gz
  • Upload date:
  • Size: 51.3 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: uv/0.11.21 {"installer":{"name":"uv","version":"0.11.21","subcommand":["publish"]},"python":null,"implementation":{"name":null,"version":null},"distro":{"name":"Ubuntu","version":"24.04","id":"noble","libc":null},"system":{"name":null,"release":null},"cpu":null,"openssl_version":null,"setuptools_version":null,"rustc_version":null,"ci":true}

File hashes

Hashes for seqfold-0.10.2.tar.gz
Algorithm Hash digest
SHA256 45e090094ff240371301bde9926b781fcef6ce7e8a9da98df5580918a51b83af
MD5 a2ae193b2a5aa116e79d57dd3a6222b3
BLAKE2b-256 beac7bfbb77d14a1fa5e8fbce564b13e0f231b6e5ede2bc200cb190cd06af9fb

See more details on using hashes here.

File details

Details for the file seqfold-0.10.2-cp38-abi3-win_arm64.whl.

File metadata

  • Download URL: seqfold-0.10.2-cp38-abi3-win_arm64.whl
  • Upload date:
  • Size: 252.2 kB
  • Tags: CPython 3.8+, Windows ARM64
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: uv/0.11.21 {"installer":{"name":"uv","version":"0.11.21","subcommand":["publish"]},"python":null,"implementation":{"name":null,"version":null},"distro":{"name":"Ubuntu","version":"24.04","id":"noble","libc":null},"system":{"name":null,"release":null},"cpu":null,"openssl_version":null,"setuptools_version":null,"rustc_version":null,"ci":true}

File hashes

Hashes for seqfold-0.10.2-cp38-abi3-win_arm64.whl
Algorithm Hash digest
SHA256 a2475acf5021fb43d8192a6a88dca149f535c70ab0dffb51736effdc29e42d5d
MD5 3397df192e1dc4f245ec6bdd9dd75b70
BLAKE2b-256 5f628be67e2e92082491048db99950dac994df6d061da3f374787f42214f9f96

See more details on using hashes here.

File details

Details for the file seqfold-0.10.2-cp38-abi3-win_amd64.whl.

File metadata

  • Download URL: seqfold-0.10.2-cp38-abi3-win_amd64.whl
  • Upload date:
  • Size: 263.3 kB
  • Tags: CPython 3.8+, Windows x86-64
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: uv/0.11.21 {"installer":{"name":"uv","version":"0.11.21","subcommand":["publish"]},"python":null,"implementation":{"name":null,"version":null},"distro":{"name":"Ubuntu","version":"24.04","id":"noble","libc":null},"system":{"name":null,"release":null},"cpu":null,"openssl_version":null,"setuptools_version":null,"rustc_version":null,"ci":true}

File hashes

Hashes for seqfold-0.10.2-cp38-abi3-win_amd64.whl
Algorithm Hash digest
SHA256 d8f075bd6738b6d82baa5bee61b3b45bc05ad5d37d2687d9bd40c54d175cf91b
MD5 5fc02ca4f5e9e9311985567917938378
BLAKE2b-256 9774be81300c239e58b4f72cc2caa492a59e6eb02dc820b1165b39fadbe99086

See more details on using hashes here.

File details

Details for the file seqfold-0.10.2-cp38-abi3-musllinux_1_2_x86_64.whl.

File metadata

  • Download URL: seqfold-0.10.2-cp38-abi3-musllinux_1_2_x86_64.whl
  • Upload date:
  • Size: 608.6 kB
  • Tags: CPython 3.8+, musllinux: musl 1.2+ x86-64
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: uv/0.11.21 {"installer":{"name":"uv","version":"0.11.21","subcommand":["publish"]},"python":null,"implementation":{"name":null,"version":null},"distro":{"name":"Ubuntu","version":"24.04","id":"noble","libc":null},"system":{"name":null,"release":null},"cpu":null,"openssl_version":null,"setuptools_version":null,"rustc_version":null,"ci":true}

File hashes

Hashes for seqfold-0.10.2-cp38-abi3-musllinux_1_2_x86_64.whl
Algorithm Hash digest
SHA256 33c310b4422a924b54bd52c48377557c5b8acf03b6411d813d145348480c2978
MD5 a58fa8255b7a2d77ca58716ac3910e90
BLAKE2b-256 bde48cbf54bd098345044c924470f83b563e054ea0e5b8c42b53e862ed43688c

See more details on using hashes here.

File details

Details for the file seqfold-0.10.2-cp38-abi3-musllinux_1_2_aarch64.whl.

File metadata

  • Download URL: seqfold-0.10.2-cp38-abi3-musllinux_1_2_aarch64.whl
  • Upload date:
  • Size: 569.2 kB
  • Tags: CPython 3.8+, musllinux: musl 1.2+ ARM64
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: uv/0.11.21 {"installer":{"name":"uv","version":"0.11.21","subcommand":["publish"]},"python":null,"implementation":{"name":null,"version":null},"distro":{"name":"Ubuntu","version":"24.04","id":"noble","libc":null},"system":{"name":null,"release":null},"cpu":null,"openssl_version":null,"setuptools_version":null,"rustc_version":null,"ci":true}

File hashes

Hashes for seqfold-0.10.2-cp38-abi3-musllinux_1_2_aarch64.whl
Algorithm Hash digest
SHA256 5f6ac1d7e31859acf65d28cc9c67ab51c15fccd72c3622b12fd81b5cbd9e72ae
MD5 63c6a3493f01069a18304ceb5bac38c4
BLAKE2b-256 4add0ac60cdd4928614068895d8cdaae66607c16f3ea25d186a25ccdfa4ac52c

See more details on using hashes here.

File details

Details for the file seqfold-0.10.2-cp38-abi3-manylinux_2_17_x86_64.manylinux2014_x86_64.whl.

File metadata

  • Download URL: seqfold-0.10.2-cp38-abi3-manylinux_2_17_x86_64.manylinux2014_x86_64.whl
  • Upload date:
  • Size: 393.3 kB
  • Tags: CPython 3.8+, manylinux: glibc 2.17+ x86-64
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: uv/0.11.21 {"installer":{"name":"uv","version":"0.11.21","subcommand":["publish"]},"python":null,"implementation":{"name":null,"version":null},"distro":{"name":"Ubuntu","version":"24.04","id":"noble","libc":null},"system":{"name":null,"release":null},"cpu":null,"openssl_version":null,"setuptools_version":null,"rustc_version":null,"ci":true}

File hashes

Hashes for seqfold-0.10.2-cp38-abi3-manylinux_2_17_x86_64.manylinux2014_x86_64.whl
Algorithm Hash digest
SHA256 b79f983eb459d3d14b90a74e362aaf020fcfaa97f4cf99aab8792ac4df174e76
MD5 d666eb79540a9d4c2260a83daeac7489
BLAKE2b-256 0e2c057e3533cbe8776f1d43c91b18c119a5cd789a50b0ab48e31bf7b38c0e86

See more details on using hashes here.

File details

Details for the file seqfold-0.10.2-cp38-abi3-manylinux_2_17_aarch64.manylinux2014_aarch64.whl.

File metadata

  • Download URL: seqfold-0.10.2-cp38-abi3-manylinux_2_17_aarch64.manylinux2014_aarch64.whl
  • Upload date:
  • Size: 391.7 kB
  • Tags: CPython 3.8+, manylinux: glibc 2.17+ ARM64
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: uv/0.11.21 {"installer":{"name":"uv","version":"0.11.21","subcommand":["publish"]},"python":null,"implementation":{"name":null,"version":null},"distro":{"name":"Ubuntu","version":"24.04","id":"noble","libc":null},"system":{"name":null,"release":null},"cpu":null,"openssl_version":null,"setuptools_version":null,"rustc_version":null,"ci":true}

File hashes

Hashes for seqfold-0.10.2-cp38-abi3-manylinux_2_17_aarch64.manylinux2014_aarch64.whl
Algorithm Hash digest
SHA256 dcd7c59730f1ee6ae8ee81ada44fb79ee468689c2048802ae614a194db5f758d
MD5 560df40d123806c294822431b880b2f4
BLAKE2b-256 f9b4d6b43e9af53a9dd079e5cf5b0a7054e5245c1d66b73b9ec74bfac80cf3b2

See more details on using hashes here.

File details

Details for the file seqfold-0.10.2-cp38-abi3-macosx_11_0_arm64.whl.

File metadata

  • Download URL: seqfold-0.10.2-cp38-abi3-macosx_11_0_arm64.whl
  • Upload date:
  • Size: 358.4 kB
  • Tags: CPython 3.8+, macOS 11.0+ ARM64
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: uv/0.11.21 {"installer":{"name":"uv","version":"0.11.21","subcommand":["publish"]},"python":null,"implementation":{"name":null,"version":null},"distro":{"name":"Ubuntu","version":"24.04","id":"noble","libc":null},"system":{"name":null,"release":null},"cpu":null,"openssl_version":null,"setuptools_version":null,"rustc_version":null,"ci":true}

File hashes

Hashes for seqfold-0.10.2-cp38-abi3-macosx_11_0_arm64.whl
Algorithm Hash digest
SHA256 7a8346fcff651d3b137086460e9bf274a30187c86812405328a2f94227b62802
MD5 09c4b31e4464e3173da87765cf58bab2
BLAKE2b-256 45d8cd3875a8a4c9e822ce298ddd41922cb954081bbcd0e32045511088efb7b6

See more details on using hashes here.

File details

Details for the file seqfold-0.10.2-cp38-abi3-macosx_10_12_x86_64.whl.

File metadata

  • Download URL: seqfold-0.10.2-cp38-abi3-macosx_10_12_x86_64.whl
  • Upload date:
  • Size: 358.9 kB
  • Tags: CPython 3.8+, macOS 10.12+ x86-64
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: uv/0.11.21 {"installer":{"name":"uv","version":"0.11.21","subcommand":["publish"]},"python":null,"implementation":{"name":null,"version":null},"distro":{"name":"Ubuntu","version":"24.04","id":"noble","libc":null},"system":{"name":null,"release":null},"cpu":null,"openssl_version":null,"setuptools_version":null,"rustc_version":null,"ci":true}

File hashes

Hashes for seqfold-0.10.2-cp38-abi3-macosx_10_12_x86_64.whl
Algorithm Hash digest
SHA256 72373175599728eaa6e50d6220310816270b6f1bcaaad04891a7d861d09e83dd
MD5 4b6fa32c9afa96a14c91be741b62f1b4
BLAKE2b-256 9a82d159497d079f9014b9d086cbf5c2dd6337db3bc6002781ca26f86a85a275

See more details on using hashes here.

Release history Release notifications | RSS feed

This release

0.10.2 This release

9 files

0.10.0

9 files

0.9.0

2 files

0.8.0

2 files

0.7.18

2 files

0.7.17

2 files

0.7.16

2 files

0.7.15

2 files

0.7.14

2 files

0.7.13

4 files

0.7.12

2 files

0.7.11

3 files

0.7.10

2 files

0.7.7

4 files

0.7.6

2 files

0.7.4

3 files

0.7.3

2 files

0.7.2

2 files

0.7.1

2 files

0.7.0

4 files

0.6.0

2 files

0.5.0

3 files

0.4.2

2 files

0.3.12

2 files

0.3.7

2 files

0.3.6

4 files

0.3.5

3 files

0.3.3

3 files

0.3.2

3 files

0.3.0

3 files

0.1.3

2 files

0.1.2

1 file

Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page